Difference between revisions of "Gene:AP"

From ICG
Jump to navigation Jump to search
Line 63: Line 63:
 
CGTTCGTTGGTACTTTTCTTTTCCTCGCGTGAAACGTCTACAGTGAATCTAATTAAACAACGTTTGAAAT
 
CGTTCGTTGGTACTTTTCTTTTCCTCGCGTGAAACGTCTACAGTGAATCTAATTAAACAACGTTTGAAAT
 
CTTATTTGGACAAAATATCGGGC</dnaseqindica>|
 
CTTATTTGGACAAAATATCGGGC</dnaseqindica>|
SOURCE = '''''Casuarina glauca''''' AP|
+
SOURCE = '''''Lilium davidii''''' AP-4 complex subunit|
 
}}
 
}}
  

Revision as of 04:17, 11 August 2017

Synonymous Genes

Experimental Validated ICGs

Species Gene Synonymous Application scenarios Publication Year
Casuarina glauca Clathrin adaptor complexes subunit
  • Different Tissues & Abiotic Stress
2015
Coffea arabica L. Clathrin adaptor complexes subunit
  • Different Genotypes & Abiotic Stress
2012
Lilium davidii AP-4 complex subunit
  • Different Experimental Conditions
2015

Featured Sequence

The Sequence of Lilium davidii AP-4 complex subunit is displayed as example.

000001 CACGGTTCAG CTCTAGCCGA AGCGAACACC TGGAGAGGTT TCGTCAGCTC GATACTACAA CAGCACCGCA 000070
000071 GCTCCTCCAA ACGAAATCTC CGAGCTCGCC ATGATCTCAC AGTTCTTCGT CCTCTCCCAG CGAGGCGACA 000140
000141 ATATCGTCTT CCGAGACTAT CGAGGCGAGG TGCAAAAAGG TAGTGCGGAG ATTTTTTTTC GCAAAGTGAA 000210
000211 ATTCTGGAAA GGCGACGAAC CTGAGGAGGC ACCACCTGTT TTTAATGTGG ACGGGGTAAA TTATCTACAT 000280
000281 GTGAAGGTTG CTGGGCTGTT TTTTGTTGCG ACCACAAGAG TTAATGTTTC ACCATCACTA GTTTTAGAGC 000350
000351 TCTTGCAAAG GATTGCACGT GTTATCAAAG ATTACCTTGG GGTCCTTAAC GAAGATTCAT TACGGAAAAA 000420
000421 TTTCGTACTT GTGTATGAAT TACTCGATGA AGTCATTGAC TTTGGTTATC CACAATCAAC ATCTACGGAG 000490
000491 GTTTTAAAAT CTTATGTATT TAATGAGCCC ATTGTGGTTG AAACTACACA TCTACCTCCT CTTGGCCCTG 000560
000561 CATCCATGTT TATGCAAGGC ACCAAACGAA TGCCTGGTAC AGCTGTTACC AAGTCAGTTG TAGCCAACGA 000630
000631 GCCTGGTGGT AAGAAGAGAG AGGAAATATT TGTTGACGTA ATTGAGAAAA TAAGTGTGAC ATTCAGCTCA 000700
000701 AGTGGTTATA TACTCACCTC GGAGATTGAT GGAACCATTC AAATGAAGAG TTATCTGACT GGAAACCCAG 000770
000771 AAATCAGATT AGCTCTTAAT GAGGATCTTA CTATTGGTAG GGATGGGGCT TCTTTATACG GTCAGGCAAC 000840
000841 AGGTTATGGT AGCTCTGCTG GAGGTGTTGT CATACTTGAT GATTGTAATT TCCATGAATC TGTACATCTG 000910
000911 GACAGTTTTG ATGCAGATAG AACTTTGACA CTGGTACCTC CAGAGGGAGA GTTTGCTGTA ATGAACTACC 000980
000981 GGATGACTCA AGAATTCAAG CCTCCGTTTC GTGTTAATGC ATTGATCGAA GAAGCAGGAT CACTTAAGGC 001050
001051 TGAAGTTATT CTAAAAGTAC GTGCTGAGTT CCTACCCAGT GTCACTGCAA ACACAATCTC AGTGCAAATG 001120
001121 CCTTTGCCAT CATATACAAC AAGAGTAAGT TTTGAGTTAG ATCCTGGCGC AGTTGGGAAT ACAACTGATT 001190
001191 TCAAGGAATC TAGCAAGAAA CTGGAATGGA ATCTGAAAAA GATTGTTGGT GGATCAGAAT ATACTCTACG 001260
001261 TGCTAAACTC ACATTTTCTC ATGAAGCCCA TGGAAATATA ACAAAGGAAG CTGGGCCTGT AAGCATGAAT 001330
001331 TTTACTATAC CCATGTACAA CGCTTCGAAG CTTCAGGTAA GATACCTTCA GATATCGAAG AAGTCGAAGA 001400
001401 CATACAATCC ATATCGATGG GTGAGGTATG TCACTCAGGC GAATTCCTAT GTAGCTCGCC TGTGAGAACT 001470
001471 GCATCTATTT TCCCTTTACT GTATGCTTGG ATCGAAGACG ATGTGGTTGT TGTGTAGTTC CTGTTCATGA 001540
001541 CAAGGATACT CTTTGGTACT TAATCCAGAT TGAGAAGTTG TACTAATGCT GTCATCTTTA TTTTTATTTA 001610
001611 CGTTCGTTGG TACTTTTCTT TTCCTCGCGT GAAACGTCTA CAGTGAATCT AATTAAACAA CGTTTGAAAT 001680
001681 CTTATTTGGA CAAAATATCG GGC

Conserved Domains

The Conserved domains of Casuarina glauca AP is displayed as example.

AP.png

External Links