Difference between revisions of "Gene:Arm"

From ICG
Jump to navigation Jump to search
(Created page with "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
Line 26: Line 26:
 
|align="center"|2013
 
|align="center"|2013
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>ACTTCTTATGAGAGCATTCCAGGATACACAGAGACGACAGTCAATAGCCAGCAGTGGCAGCCAGCAACCA
 +
GGAGCTTATGCTGATGGCGTTCGCATGGAAGAAATTGTTGAAGGAACTGTTGGAGCCCTGCATATTTTAG
 +
CACGCGAGTCGAACAACAGAGCTATTATCCGCGGACAAATGGTTATACCAATCTTTGTTCAGCTTCTGTT
 +
TAACGAGATAGAGAACATACAGAGAGTTGCTGCTGGAGTTCTCTGTGAACTAGCAGCAGACA
 +
</dnaseqindica>|
 +
SOURCE = '''''Chortoicetes terminifera''''' Arm|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==

Revision as of 07:19, 10 August 2017

Synonymous Genes

Experimental Validated ICGs

Species Gene Synonymous Application scenarios Publication Year
Chortoicetes terminifera Armadillo
  • Density-Dependent Behavioural plasticity
2011
Diploptera punctata Armadillo
  • During Gonadotrophic Cycle
2013

Featured Sequence

The Sequence of Chortoicetes terminifera Arm is displayed as example.

000001 ACTTCTTATG AGAGCATTCC AGGATACACA GAGACGACAG TCAATAGCCA GCAGTGGCAG CCAGCAACCA 000070
000071 GGAGCTTATG CTGATGGCGT TCGCATGGAA GAAATTGTTG AAGGAACTGT TGGAGCCCTG CATATTTTAG 000140
000141 CACGCGAGTC GAACAACAGA GCTATTATCC GCGGACAAAT GGTTATACCA ATCTTTGTTC AGCTTCTGTT 000210
000211 TAACGAGATA GAGAACATAC AGAGAGTTGC TGCTGGAGTT CTCTGTGAAC TAGCAGCAGA CA

External Links