Difference between revisions of "Gene:Cyclophilin"

From ICG
Jump to navigation Jump to search
(Created page with "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
 
(9 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* Cyclophilin <=> Cyc,CYP,GhCYP1,CYC1,PPIA
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 121: Line 122:
 
*[https://www.ncbi.nlm.nih.gov/pubmed/23508400 Validation of reference genes for gene expression analysis in Valsa mali var. mali using real-time quantitative PCR]
 
*[https://www.ncbi.nlm.nih.gov/pubmed/23508400 Validation of reference genes for gene expression analysis in Valsa mali var. mali using real-time quantitative PCR]
 
|align="center"|2013
 
|align="center"|2013
 +
|-
 +
|align="center"|[[Aspergillus niger]]
 +
|align="center"|Cytochrome c oxidase subunit V
 +
||
 +
*''Continuous Cultivation''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/17868942 Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger]
 +
|align="center"|2007
 +
|-
 +
|align="center"|[[Ipomoea batatas]]
 +
|align="center"|Cytochrome c oxidase subunit Vc
 +
||
 +
*''Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23251557 Stable internal reference genes for the normalization of real-time PCR in different sweetpotato cultivars subjected to abiotic stress conditions]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Callithrix jacchus]]
 +
|align="center"|Peptidylprolyl isomerace (Cyclophilin) A
 +
||
 +
*''Different Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24068436 Selection of suitable reference genes for mRNA quantification studies using common marmoset tissues]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Capra hircus]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) B
 +
||
 +
*''Intramuscular Fat Deposition''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25794179 Selection of reference genes for gene expression studies related to intramuscular fat deposition in Capra hircus skeletal muscle]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|Peptidylprolyl isomerase A, cydophilin A, romatase A
 +
||
 +
*''Lung Cancer''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25573171 Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) A
 +
||
 +
*''Ovarian Cancer''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/19622337 Identification of suitable reference genes for gene expression studies of human serous ovarian cancer by real-time polymerase chain reaction]
 +
|align="center"|2009
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) A
 +
||
 +
*''Endometrioid Endometrial Carcinoma Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25473950 Identification of optimal reference genes for gene expression normalization in a wide cohort of endometrioid endometrial carcinoma tissues]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) A 
 +
||
 +
*''Clear Cell Renal Cell Carcinoma''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24885929 Validation of housekeeping gene and impact on normalized gene expression in clear cell renal cell carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Mus musculus]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) B
 +
||
 +
*''Different Tissues & Ageing''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25663136 Normalization of Reverse Transcription Quantitative PCR Data During Ageing in Distinct Cerebral Structures. Molecular neurobiology]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Mus musculus]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) A
 +
||
 +
*''Testis Development''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24952483 Identification and validation of suitable reference genes for RT-qPCR analysis in mouse testis development]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Mus musculus]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) B
 +
||
 +
*''Intestinal Epithelial Cells''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23292893 Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Rattus norvegicus]]
 +
|align="center"|Peptidylprolyl isomerase B, Peptidylprolyl cistrans isomerase (Cyclophilin) A
 +
||
 +
*''Intestinal Epithelial Cells''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23292893 Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Sus scrofa]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) A
 +
||
 +
*''Spermatozoa Cryopreservation''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24440873 Selection of optimal reference genes for quantitative RT-PCR studies of boar spermatozoa cryopreservation]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Sus scrofa]]
 +
|align="center"|Peptidylprolyl isomerase (Cyclophilin) A
 +
||
 +
*''Gastrointestinal Tissues''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S1871141310002325 Selection of stable reference genes for quantitative real-time PCR in porcine gastrointestinal tissues]
 +
|align="center"|2010
 +
|}
  
|}
+
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>GGGGCCGAACGTGGTATAAAAGGGGCGGGAGGCCAGGCTCGTGCCGTTTTGCAGACGCCACCGCCGAGGA
 +
AAACCGTGTACTATTAGCCATGGTCAACCCCACCGTGTTCTTCGACATTGCCGTCGACGGCGAGCCCTTG
 +
GGCCGCGTCTCCTTTGAGCTGTTTGCAGACAAGGTCCCAAAGACAGCAGAAAATTTTCGTGCTCTGAGCA
 +
CTGGAGAGAAAGGATTTGGTTATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCAGGG
 +
TGGTGACTTCACACGCCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGAAGATGAGAAC
 +
TTCATCCTAAAGCATACGGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGTTCCC
 +
AGTTTTTCATCTGCACTGCCAAGACTGAGTGGTTGGATGGCAAGCATGTGGTGTTTGGCAAAGTGAAAGA
 +
AGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACC
 +
ATTGCTGACTGTGGACAACTCGAATAAGTTTGACTTGTGTTTTATCTTAACCACCAGATCATTCCTTCTG
 +
TAGCTCAGGAGAGCACCCCTCCACCCCATTTGCTCGCAGTATCCTAGAATCTTTGTGCTCTCGCTGCAGT
 +
TCCCTTTGGGTTCCATGTTTTCCTTGTTCCCTCCCATGCCTAGCTGGATTGCAGAGTTAAGTTTATGATT
 +
ATGAAATAAAAACTAAATAACAATTGTCCTCGTTTGAGTTAAGAGTGTTGATGTAGGCTTTATTTTAAGC
 +
AGTAATGGGTTACTTCTGAAACATCACTTGTTTGCTTAATTCTACACAGTACTTAGATTTTTTTTACTTT
 +
CCAGTCCCAGGAAGTGTCAATGTTTGTTGAGTGGAATATTGAAAATGTAGGCAGCAACTGGGCATGGTGG
 +
CTCACTGTCTGTAATGTATTACCTGAGGCAGAAGACCACCTGAGGGTAGGAGTCAAGATCAGCCTGGGCA
 +
ACATAGTGAGACGCTGTCTCTACAAAAAATAATTAGCCTGGCCTGGTGGTGCATGCCTAGTCCTAGCTGA
 +
TCTGGAGGCTGACGTGGGAGGATTGCTTGAGCCTAGAGTGAGCTATTATCATGCCACTGTACAGCCTGGG
 +
TGTTCACAGATCTTGTGTCTCAAAGGTAGGCAGAGGCAGGAAAAGCAAGGAGCCAGAATTAAGAGGTTGG
 +
GTCAGTCTGCAGTGAGTTCATGCATTTAGAGGTGTTCTTCAAGATGACTAATGTCAAAAATTGAGACATC
 +
TGTTGCGGTTTTTTTTTTTTTTTTTTCCCCTGGAATGCAGTGGCGTGATCTCAGCTCACTGCAGCCTCCG
 +
CCTCCTGGGTTCAAGTGATTCTAGTGCCTCAGCCTCCTGAGTAGCTGGGATAATGGGCGTGTGCCACCAT
 +
GCCCAGCTAATTTTTGTATTTTTAGTATAGATGGGGTTTCATCATTTTGACCAGGCTGGTCTCAAACTCT
 +
TGACCTCAGCTGATGCGCCTGCCTTGGCCTCCCAAACTGCTGAGATTACAGATGTGAGCCACCGCACCCT
 +
ACCTCATTTTCTGTAACAAAGCTAAGCTTGAACACTGTTGATGTTCTTGAGGGAAGCATATTGGGCTTTA
 +
GGCTGTAGGTCAAGTTTATACATCTTAATTATGGTGGAATTCCTATGTAGAGTCTAAAAAGCCAGGTACT
 +
TGGTGCTACAGTCAGTCTCCCTGCAGAGGGTTAAGGCGCAGACTACCTGCAGTGAGGAGGTACTGCTTGT
 +
AGCATATAGAGCCTCTCCCTAGCTTTGGTTATGGAGGCTTTGAGGTTTTGCAAACCTGACCAATTTAAGC
 +
CATAAGATCTGGTCAAAGGGATACCCTTCCCACTAAGGACTTGGTTTCTCAGGAAATTATATGTACAGTG
 +
CTTGCTGGCAGTTAGATGTCAGGACAATCTAAGCTGAGAAAACCCCTTCTCTGCCCACCTTAACAGACCT
 +
CTAGGGTTCTTAACCCAGCAATCAAGTTTGCCTATCCTAGAGGTGGCGGATTTGATCATTTGGTGTGTTG
 +
GGCAATTTTTGTTTTACTGTCTGGTTCCTTCTGCGTGAATTACCACCACCACCACTTGTGCATCTCAGTC
 +
TTGTGTGTTGTCTGGTTACGTATTCCCTGGGTGATACCATTCAATGTCTTAATGTACTTGTGGCTCAGAC
 +
CTGAGTGCAAGGTGGAAATAAACATCAAACATCTTTTCATTATCCCTA
 +
</dnaseqindica>|
 +
SOURCE = '''''Homo sapiens''''' Cyclophilin|
 +
}}
 +
 
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Homo sapiens''''' Cyclophilin|
 +
Str= [[File:Cyclophilin.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:Cyclophilin]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
+
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=cd01926 Conserved Protein Domain Family ]
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
+
* [https://en.wikipedia.org/wiki/Cyclophilin WikiPedia]
* [http://pfam.xfam.org/family/SAND Pfam]
+
* [http://pfam.xfam.org/family/PF00160 Pfam]

Latest revision as of 02:19, 30 August 2017

Synonymous Genes

  • Cyclophilin <=> Cyc,CYP,GhCYP1,CYC1,PPIA

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Anthurium andraeanum Cyclophilin
  • Spathe Tissue
2013
Brassica rapa subsp. pekinensis Cyclophilin
  • Different Developmental Stages & Biotic Stress
2012
Coffea arabica L. Cyclophilin
  • Different Genotypes & Abiotic Stress
2012
Elaeis guineensis Cyclophilin
  • Abiotic Stress
2014
Glycine max Cyclophilin
  • Biotic Stresses
2015
Gossypium hirsutum Cydophilin 1
  • Abiotic Stress
2013
Homo sapiens Cytochrome c-1
  • Glioma
2015
Homo sapiens Peptidylprolyl isomerase A
  • Epicardial Adipose Tissue
2012
Iris hybrid cultivar Cyclophilin
  • Abiotic Stress
2014
Lilium regale Cycolphilin A
  • Different Developmental Stages & Abiotic Stress
2016
Panicum virgatum Cyclophilin 5
  • Different Tissues & Abiotic Stress
2014
Rattus norvegicus Cyclophilin A
  • Asphyxial Cardiac Arrest Model
2008
Solanum lycopersicum Cyclophilin (peptidyl-prolylcis–trans isomerase)
  • Viral Infection
2010
Valsa mali var. mali Cyclophilin
  • Different Strains & Abiotic Stress Treatments
2013
Aspergillus niger Cytochrome c oxidase subunit V
  • Continuous Cultivation
2007
Ipomoea batatas Cytochrome c oxidase subunit Vc
  • Abiotic Stress
2012
Callithrix jacchus Peptidylprolyl isomerace (Cyclophilin) A
  • Different Tissues
2013
Capra hircus Peptidylprolyl isomerase (Cyclophilin) B
  • Intramuscular Fat Deposition
2015
Homo sapiens Peptidylprolyl isomerase A, cydophilin A, romatase A
  • Lung Cancer
2015
Homo sapiens Peptidylprolyl isomerase (Cyclophilin) A
  • Ovarian Cancer
2009
Homo sapiens Peptidylprolyl isomerase (Cyclophilin) A
  • Endometrioid Endometrial Carcinoma Tissues
2014
Homo sapiens Peptidylprolyl isomerase (Cyclophilin) A
  • Clear Cell Renal Cell Carcinoma
2014
Mus musculus Peptidylprolyl isomerase (Cyclophilin) B
  • Different Tissues & Ageing
2016
Mus musculus Peptidylprolyl isomerase (Cyclophilin) A
  • Testis Development
2014
Mus musculus Peptidylprolyl isomerase (Cyclophilin) B
  • Intestinal Epithelial Cells
2013
Rattus norvegicus Peptidylprolyl isomerase B, Peptidylprolyl cistrans isomerase (Cyclophilin) A
  • Intestinal Epithelial Cells
2013
Sus scrofa Peptidylprolyl isomerase (Cyclophilin) A
  • Spermatozoa Cryopreservation
2014
Sus scrofa Peptidylprolyl isomerase (Cyclophilin) A
  • Gastrointestinal Tissues
2010

Featured Sequence

The Sequence of Homo sapiens Cyclophilin is displayed as example.

000001 GGGGCCGAAC GTGGTATAAA AGGGGCGGGA GGCCAGGCTC GTGCCGTTTT GCAGACGCCA CCGCCGAGGA 000070
000071 AAACCGTGTA CTATTAGCCA TGGTCAACCC CACCGTGTTC TTCGACATTG CCGTCGACGG CGAGCCCTTG 000140
000141 GGCCGCGTCT CCTTTGAGCT GTTTGCAGAC AAGGTCCCAA AGACAGCAGA AAATTTTCGT GCTCTGAGCA 000210
000211 CTGGAGAGAA AGGATTTGGT TATAAGGGTT CCTGCTTTCA CAGAATTATT CCAGGGTTTA TGTGTCAGGG 000280
000281 TGGTGACTTC ACACGCCATA ATGGCACTGG TGGCAAGTCC ATCTATGGGG AGAAATTTGA AGATGAGAAC 000350
000351 TTCATCCTAA AGCATACGGG TCCTGGCATC TTGTCCATGG CAAATGCTGG ACCCAACACA AATGGTTCCC 000420
000421 AGTTTTTCAT CTGCACTGCC AAGACTGAGT GGTTGGATGG CAAGCATGTG GTGTTTGGCA AAGTGAAAGA 000490
000491 AGGCATGAAT ATTGTGGAGG CCATGGAGCG CTTTGGGTCC AGGAATGGCA AGACCAGCAA GAAGATCACC 000560
000561 ATTGCTGACT GTGGACAACT CGAATAAGTT TGACTTGTGT TTTATCTTAA CCACCAGATC ATTCCTTCTG 000630
000631 TAGCTCAGGA GAGCACCCCT CCACCCCATT TGCTCGCAGT ATCCTAGAAT CTTTGTGCTC TCGCTGCAGT 000700
000701 TCCCTTTGGG TTCCATGTTT TCCTTGTTCC CTCCCATGCC TAGCTGGATT GCAGAGTTAA GTTTATGATT 000770
000771 ATGAAATAAA AACTAAATAA CAATTGTCCT CGTTTGAGTT AAGAGTGTTG ATGTAGGCTT TATTTTAAGC 000840
000841 AGTAATGGGT TACTTCTGAA ACATCACTTG TTTGCTTAAT TCTACACAGT ACTTAGATTT TTTTTACTTT 000910
000911 CCAGTCCCAG GAAGTGTCAA TGTTTGTTGA GTGGAATATT GAAAATGTAG GCAGCAACTG GGCATGGTGG 000980
000981 CTCACTGTCT GTAATGTATT ACCTGAGGCA GAAGACCACC TGAGGGTAGG AGTCAAGATC AGCCTGGGCA 001050
001051 ACATAGTGAG ACGCTGTCTC TACAAAAAAT AATTAGCCTG GCCTGGTGGT GCATGCCTAG TCCTAGCTGA 001120
001121 TCTGGAGGCT GACGTGGGAG GATTGCTTGA GCCTAGAGTG AGCTATTATC ATGCCACTGT ACAGCCTGGG 001190
001191 TGTTCACAGA TCTTGTGTCT CAAAGGTAGG CAGAGGCAGG AAAAGCAAGG AGCCAGAATT AAGAGGTTGG 001260
001261 GTCAGTCTGC AGTGAGTTCA TGCATTTAGA GGTGTTCTTC AAGATGACTA ATGTCAAAAA TTGAGACATC 001330
001331 TGTTGCGGTT TTTTTTTTTT TTTTTTCCCC TGGAATGCAG TGGCGTGATC TCAGCTCACT GCAGCCTCCG 001400
001401 CCTCCTGGGT TCAAGTGATT CTAGTGCCTC AGCCTCCTGA GTAGCTGGGA TAATGGGCGT GTGCCACCAT 001470
001471 GCCCAGCTAA TTTTTGTATT TTTAGTATAG ATGGGGTTTC ATCATTTTGA CCAGGCTGGT CTCAAACTCT 001540
001541 TGACCTCAGC TGATGCGCCT GCCTTGGCCT CCCAAACTGC TGAGATTACA GATGTGAGCC ACCGCACCCT 001610
001611 ACCTCATTTT CTGTAACAAA GCTAAGCTTG AACACTGTTG ATGTTCTTGA GGGAAGCATA TTGGGCTTTA 001680
001681 GGCTGTAGGT CAAGTTTATA CATCTTAATT ATGGTGGAAT TCCTATGTAG AGTCTAAAAA GCCAGGTACT 001750
001751 TGGTGCTACA GTCAGTCTCC CTGCAGAGGG TTAAGGCGCA GACTACCTGC AGTGAGGAGG TACTGCTTGT 001820
001821 AGCATATAGA GCCTCTCCCT AGCTTTGGTT ATGGAGGCTT TGAGGTTTTG CAAACCTGAC CAATTTAAGC 001890
001891 CATAAGATCT GGTCAAAGGG ATACCCTTCC CACTAAGGAC TTGGTTTCTC AGGAAATTAT ATGTACAGTG 001960
001961 CTTGCTGGCA GTTAGATGTC AGGACAATCT AAGCTGAGAA AACCCCTTCT CTGCCCACCT TAACAGACCT 002030
002031 CTAGGGTTCT TAACCCAGCA ATCAAGTTTG CCTATCCTAG AGGTGGCGGA TTTGATCATT TGGTGTGTTG 002100
002101 GGCAATTTTT GTTTTACTGT CTGGTTCCTT CTGCGTGAAT TACCACCACC ACCACTTGTG CATCTCAGTC 002170
002171 TTGTGTGTTG TCTGGTTACG TATTCCCTGG GTGATACCAT TCAATGTCTT AATGTACTTG TGGCTCAGAC 002240
002241 CTGAGTGCAA GGTGGAAATA AACATCAAAC ATCTTTTCAT TATCCCTA

Conserved Domains

The Conserved domains of Homo sapiens Cyclophilin is displayed as example.

Cyclophilin.png

External Links