Difference between revisions of "Gene:DNAJ"

From ICG
Jump to navigation Jump to search
(Created page with "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
Line 35: Line 35:
  
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>TCCGGTCCCACGGCATCCGCCTCGCCCGCCGCTCCCTTTCCTCCATTCTGCTCCACAATTCGCCGTCCTC
 +
TTTATGTGATTCGTTGTTGAAAGAGGGCTGCAGGAACTTCAGCACTGCGTTGTTTGATCAATCTAGAGTT
 +
CCTTTTAGTTCCAATTTTGGAAATGTTGGTAATGAGAAGTATTGTATGAAGCTGGGATCATTTGGTGAAA
 +
ATTTAGGCGCAGCACGGTCAATTCATAGCACTGGACATTTGTCAAGAGATTATTACGATGTACTGGGCAT
 +
CAGTAAAAATGCAACTGCATCAGAAATTAAAAAAGCTTATTATGGGCTAGCAAAGAAGTTGCATCCAGAT
 +
ACAAATAAAGATGACCCAGAAGCTGAGAAGAAATTCCAAGAAGTTCAGAAGGCATATGAGGTCTTGAAAG
 +
ATGAAGAAAAGCGCCAGCAATATGATCAGATTGGCCATGAAGCTTTTGAACGCGCTGGTAATGGCGAAGG
 +
TCCAGGATTTGATCCATTTGGAGGTGGCTTTAATCCTTTCCAGGACATATTTAGAAATGCTGATATTTTT
 +
AACATCTTCAACAGGGACATGGGGGGCGAAGATGTCAAGGTTTCAGTTGAACTTTCCTTTATAGAAGCTG
 +
TCCAGGGATGCACCAAAACATTGTCAATCCTGACTGATTTGGCTTGCAATACTTGTGGTGGAACTGGCGT
 +
TCCTCCTGGGACCAGGCCTGAAACTTGTAAACGCTGTAGAGGCTCTGGCATGACTATATCACAAAATGGT
 +
CCGTTCACACTTCAATCTACTTGTCCAAATTGCGGAGGAGCTGGAAAAATTGTATCGAGCTTCTGCAAGT
 +
CTTGCAAGGGTAAACGGGTGGTGAAAGGGACAAAAACAGTGAAGTTGAACGTCATGCCTGGGGTGGACAA
 +
CAATGAAACTATTAAGATTCCCAGAAGTGGCGGAGCTGACCCTGATGGAAATCATCCTGGTGATCTATAT
 +
GTCATGATCAAGGTTAGAGAAGATCCAGTGTTCCGCAGAGAAGGGGCTGATATCCATGTTGATGCAGTAT
 +
TAAGCATCAGTCAGGCAATCCTGGGAGGAACAATCCAGGTGCCAACTCTGACTGGGGATGTTGTCGTTAA
 +
GGTGCGACCTGGCACTCAACCTGGCCAAAAGGTGGTGTTGAGGAAAAAAGGGATTAAAATCAGAAACTCT
 +
TTTTCGTTCGGCGATGAGTACGTGCACTTCAATGTCAGCATCCCGACAAACCTGACCCAGAGGCAGCGCC
 +
AATTGATTGAGGAGTTTGCCAAAGAAGAGCAAGGGGAAGATGATAAAGGGGCAGCTGCAAGTGCATCAGG
 +
TTGAACCCTATAACAACTCTGTCGTGCATTAAATTGGCAGTGCTGAAGAAAAAGAATCATAAATTCATAC
 +
ATGGCCTTCATTTCCTGGAGGTGAAAGATTTTGGCCAAGCAATTTTGAGTTAGGAGGTAGAAGATTACAA
 +
TATTTTTGTACCTTCCCGTTGTGGGGTAGGATATGTAATATTTCTTGGTATCCAAAACTATCCATAATAA
 +
ACCTGAGAACATCAGAAGAACAACAATTGTTATAGATGGTATTGTGCTGAAAATCAGGTTGGCCAGCAGT
 +
TAACAATGTTGTACATAAAACACATTAGTTTTCAGAAGATGCAGCCACTAGATGCTTGTTAGTTTCATTT
 +
AGTGACTTGCTATAGCAGCT</dnaseqindica>|
 +
SOURCE = '''''Sesamum indicum''''' DNAJ|
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Sesamum indicum''''' DNAJ|
 +
Str= [[File:DNAJ.png|center|770px|]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==

Revision as of 02:46, 10 August 2017

Synonymous Genes

Experimental Validated ICGs

Species Gene Synonymous Application scenarios Publication Year
Corchorus capsularis Chaperone protein dnaJ
  • Different Tissues & Abiotic Stress
2015
Salicornia europaea DnaJ-like protein
  • Abiotic Stress
2014
Sesamum indicum DnaJ protein-like
  • Different Developmental Stages & Abiotic Stress
2013

Featured Sequence

The Sequence of Sesamum indicum DNAJ is displayed as example.

000001 TCCGGTCCCA CGGCATCCGC CTCGCCCGCC GCTCCCTTTC CTCCATTCTG CTCCACAATT CGCCGTCCTC 000070
000071 TTTATGTGAT TCGTTGTTGA AAGAGGGCTG CAGGAACTTC AGCACTGCGT TGTTTGATCA ATCTAGAGTT 000140
000141 CCTTTTAGTT CCAATTTTGG AAATGTTGGT AATGAGAAGT ATTGTATGAA GCTGGGATCA TTTGGTGAAA 000210
000211 ATTTAGGCGC AGCACGGTCA ATTCATAGCA CTGGACATTT GTCAAGAGAT TATTACGATG TACTGGGCAT 000280
000281 CAGTAAAAAT GCAACTGCAT CAGAAATTAA AAAAGCTTAT TATGGGCTAG CAAAGAAGTT GCATCCAGAT 000350
000351 ACAAATAAAG ATGACCCAGA AGCTGAGAAG AAATTCCAAG AAGTTCAGAA GGCATATGAG GTCTTGAAAG 000420
000421 ATGAAGAAAA GCGCCAGCAA TATGATCAGA TTGGCCATGA AGCTTTTGAA CGCGCTGGTA ATGGCGAAGG 000490
000491 TCCAGGATTT GATCCATTTG GAGGTGGCTT TAATCCTTTC CAGGACATAT TTAGAAATGC TGATATTTTT 000560
000561 AACATCTTCA ACAGGGACAT GGGGGGCGAA GATGTCAAGG TTTCAGTTGA ACTTTCCTTT ATAGAAGCTG 000630
000631 TCCAGGGATG CACCAAAACA TTGTCAATCC TGACTGATTT GGCTTGCAAT ACTTGTGGTG GAACTGGCGT 000700
000701 TCCTCCTGGG ACCAGGCCTG AAACTTGTAA ACGCTGTAGA GGCTCTGGCA TGACTATATC ACAAAATGGT 000770
000771 CCGTTCACAC TTCAATCTAC TTGTCCAAAT TGCGGAGGAG CTGGAAAAAT TGTATCGAGC TTCTGCAAGT 000840
000841 CTTGCAAGGG TAAACGGGTG GTGAAAGGGA CAAAAACAGT GAAGTTGAAC GTCATGCCTG GGGTGGACAA 000910
000911 CAATGAAACT ATTAAGATTC CCAGAAGTGG CGGAGCTGAC CCTGATGGAA ATCATCCTGG TGATCTATAT 000980
000981 GTCATGATCA AGGTTAGAGA AGATCCAGTG TTCCGCAGAG AAGGGGCTGA TATCCATGTT GATGCAGTAT 001050
001051 TAAGCATCAG TCAGGCAATC CTGGGAGGAA CAATCCAGGT GCCAACTCTG ACTGGGGATG TTGTCGTTAA 001120
001121 GGTGCGACCT GGCACTCAAC CTGGCCAAAA GGTGGTGTTG AGGAAAAAAG GGATTAAAAT CAGAAACTCT 001190
001191 TTTTCGTTCG GCGATGAGTA CGTGCACTTC AATGTCAGCA TCCCGACAAA CCTGACCCAG AGGCAGCGCC 001260
001261 AATTGATTGA GGAGTTTGCC AAAGAAGAGC AAGGGGAAGA TGATAAAGGG GCAGCTGCAA GTGCATCAGG 001330
001331 TTGAACCCTA TAACAACTCT GTCGTGCATT AAATTGGCAG TGCTGAAGAA AAAGAATCAT AAATTCATAC 001400
001401 ATGGCCTTCA TTTCCTGGAG GTGAAAGATT TTGGCCAAGC AATTTTGAGT TAGGAGGTAG AAGATTACAA 001470
001471 TATTTTTGTA CCTTCCCGTT GTGGGGTAGG ATATGTAATA TTTCTTGGTA TCCAAAACTA TCCATAATAA 001540
001541 ACCTGAGAAC ATCAGAAGAA CAACAATTGT TATAGATGGT ATTGTGCTGA AAATCAGGTT GGCCAGCAGT 001610
001611 TAACAATGTT GTACATAAAA CACATTAGTT TTCAGAAGAT GCAGCCACTA GATGCTTGTT AGTTTCATTT 001680
001681 AGTGACTTGC TATAGCAGCT

Conserved Domains

The Conserved domains of Sesamum indicum DNAJ is displayed as example.

DNAJ.png

External Links