Difference between revisions of "Gene:EF1A"

From ICG
Jump to navigation Jump to search
m (Xysj2012 moved page Gene:EF1α to Gene:EF1A without leaving a redirect)
Line 698: Line 698:
 
|align="center"|2014
 
|align="center"|2014
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{DNA|
 +
DNA = <dnaseqindica>CTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGCCAAAATGGGAA
 +
AGGAAAAGACTCATATCAACATTGTCGTCATTGGACACGTAGATTCGGGCAAGTCCACCACTACTGGCCA
 +
TCTGATCTATAAATGCGGTGGCATCGACAAAAGAACCATTGAAAAATTTGAGAAGGAGGCTGCTGAGATG
 +
GGAAAGGGCTCCTTCAAGTATGCCTGGGTCTTGGATAAACTGAAAGCTGAGCGTGAACGTGGTATCACCA
 +
TTGATATCTCCTTGTGGAAATTTGAGACCAGCAAGTACTATGTGACTATCATTGATGCCCCAGGACACAG
 +
AGACTTTATCAAAAACATGATTACAGGGACATCTCAGGCTGACTGTGCTGTCCTGATTGTTGCTGCTGGT
 +
GTTGGTGAATTTGAAGCTGGTATCTCCAAGAATGGGCAGACCCGAGAGCATGCCCTTCTGGCTTACACAC
 +
TGGGTGTGAAACAACTAATTGTCGGTGTTAACAAAATGGATTCCACTGAGCCACCCTACAGCCAGAAGAG
 +
ATATGAGGAAATTGTTAAGGAAGTCAGCACTTACATTAAGAAAATTGGCTACAACCCCGACACAGTAGCA
 +
TTTGTGCCAATTTCTGGTTGGAATGGTGACAACATGCTGGAGCCAAGTGCTAACATGCCTTGGTTCAAGG
 +
GATGGAAAGTCACCCGTAAGGATGGCAATGCCAGTGGAACCACGCTGCTTGAGGCTCTGGACTGCATCCT
 +
ACCACCAACTCGTCCAACTGACAAGCCCTTGCGCCTGCCTCTCCAGGATGTCTACAAAATTGGTGGTATT
 +
GGTACTGTTCCTGTTGGCCGAGTGGAGACTGGTGTTCTCAAACCCGGTATGGTGGTCACCTTTGCTCCAG
 +
TCAACGTTACAACGGAAGTAAAATCTGTCGAAATGCACCATGAAGCTTTGAGTGAAGCTCTTCCTGGGGA
 +
CAATGTGGGCTTCAATGTCAAGAATGTGTCTGTCAAGGATGTTCGTCGTGGCAACGTTGCTGGTGACAGC
 +
AAAAATGACCCACCAATGGAAGCAGCTGGCTTCACTGCTCAGGTGATTATCCTGAACCATCCAGGCCAAA
 +
TAAGCGCCGGCTATGCCCCTGTATTGGATTGCCACACGGCTCACATTGCATGCAAGTTTGCTGAGCTGAA
 +
GGAAAAGATTGATCGCCGTTCTGGTAAAAAGCTGGAAGATGGCCCTAAATTCTTGAAGTCTGGTGATGCT
 +
GCCATTGTTGATATGGTTCCTGGCAAGCCCATGTGTGTTGAGAGCTTCTCAGACTATCCACCTTTGGGTC
 +
GCTTTGCTGTTCGTGATATGAGACAGACAGTTGCGGTGGGTGTCATCAAAGCAGTGGACAAGAAGGCTGC
 +
TGGAGCTGGCAAGGTCACCAAGTCTGCCCAGAAAGCTCAGAAGGCTAAATGAATATTATCCCTAATACCT
 +
GCCACCCCACTCTTAATCAGTGGTGGAAGAACGGTCTCAGAACTGTTTGTTTCAATTGGCCATTTAAGTT
 +
TAGTAGTAAAAGACTGGTTAATGATAACAATGCATCGTAAAACCTTCAGAAGGAAAGGAGAATGTTTTGT
 +
GGACCACTTTGGTTTTCTTTTTTGCGTGTGGCAGTTTTAAGTTATTAGTTTTTAAAATCAGTACTTTTTA
 +
ATGGAAACAACTTGACCAAAAATTTGTCACAGAATTTTGAGACCCATTAAAAAAGTTAAATGAGAAACCT
 +
GTGTGTTCCTTTGGTCAACACCGAGACATTTAGGTGAAAGACATCTAATTCTGGTTTTACGAATCTGGAA
 +
ACTTCTTGAAAATGTAATTCTTGAGTTAACACTTCTGGGTGGAGAATAGGGTTGTTTTCCCCCCACATAA
 +
TTGGAAGGGGAAGGAATATCATTTAAAGCTATGGGAGGGTTGCTTTGATTACAACACTGGAGAGAAATGC
 +
AGCATGTTGCTGATTGCCTGTCACTAAAACAGGCCAAAAACTGAGTCCTTGTGTTGCATAGAAAGCTTCA
 +
TGTTGCTAAACCAATGTTAAGTGAATCTTTGGAAACAAAATGTTTCCAAATTACTGGGATGTGCATGTTG
 +
AAACGTGGGTTAAAATGACTGGGCAGTGAAAGTTGACTATTTGCCATGACATAAGAAATAAGTGTAGTGG
 +
CTAGTGTACACCCTATGAGTGGAAGGGTCCATTTTGAAGTCAGTGGAGTAAGCTTTATGCCAGTTTGATG
 +
GTTTCACAAGTTCTATTGAGTGCTATTCAGAATAGGAACAAGGTTCTAATAGAAAAAGATGGCAATTTGA
 +
AGTAGCTATAAAATTAGACTAATCTACATTGCTTTTCTCCTGCAGAGTCTAATACCTTTTATGCTTTGAT
 +
AATTAGCAGTTTGTCTACTTGGTCACTAGGAATGAAACTACATGGTAATAGGCTTAACAGGTGTAATAGC
 +
CCACTTACTCCTGAATCTTTAAGCATTTGTGCATTTGAAAAATGCTTTTCGCGATCTTCCTGCTGGGATT
 +
ACAGGCATGAGCCACTGTGCCTGACCTCCCATATGTAAAAGTGTCTAAAGGTTTTTTTTTGGTTATAAAA
 +
GGAAAATTTTTGCTTAAGTTTGAAGGATAGGTAAAATTAAAGGACATGCTTTCTGTTTGTGTGATGGTTT
 +
TTAAAAATTTTTTTTAAGATGGAGTTCTTGTTGCCCAGGCTAGAATGCAATGGCAAAATCTCACTGCAAT
 +
CTCCTCCTCCTGGGTTCAAGCAATTCTCCTACTTCAGCCTCCCAAGTAGCTGGGATTACAGGCATGTGCT
 +
AATTTGGTGTTTTTAATAGAGATGAGGTTTTTCCATGTTGGTCAGGCTGGTCTCAAACTCCTGACCTTAG
 +
GTGATCGCCTCGGCCTCCTAAAGTGCTGGAATTACAGGCATGAGCCACCATGCCTGGCCAGGACATGTGT
 +
TCTTAAGGACATGCTAAGCAGGAGTTAAAGCAGCCCAAGAGATAAGGCCTCTTAAAGTGACTGGCAATGT
 +
GTATTGCTCAAGATTCAAAGGTACTTGAATTGGCCATAGACAAGTCTGTAATGAAGTGTTATCGTTTTCC
 +
CTCATCTGAGTCTGAATTAGATAAAATGCCTTCCCATCAGCCAGTGCTCTGAGGTATCAAGTCTAAATTG
 +
AACTAGAGATTTTTGTCCTTAGTTTCTTTGCTATCTAATGTTTACACAAGTAAATAGTCTAAGATTTGCT
 +
GGATGACAGAAAAAACAGGTAAGGCCTTTAATAGATGGCCAATAGATGCCCTGATAATGAAAGTTGACAC
 +
CTGTAAGATTTACCAGTAGAGAATTCTTGACATGCAAGGAAGCAAGATTTAACTGAAAAATTGTTCCCAC
 +
TGGAAGCAGGAATGAGTCAGTTTACTTGCATATACTGAGATTGAGATTAACTTCCTGTGAAACCCAGTGT
 +
CTTAGACAACTGTGGCTTGAGCACCACCTGCTGGTATTCATTACAAACTTGCTCACTACAATAAATGAAT
 +
TTTAAGCTTTAAAAAAAAAAAAAAAAAA</dnaseqindica>|
 +
SOURCE = |
 +
 +
}
 +
 +
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==

Revision as of 02:52, 8 August 2017

Synonymous Genes

Experimental Validated ICGs

Species Gene Synonymous Application scenarios Publication Year
Agrostis stolonifera Elongation factor-1a
  • Abiotic Stresses
2015
Ammopiptanthus mongolicus Elongation factor 1-alpha
  • Abiotic Stresses
2012
Anastrepha obliqua Elongation factor-1 alpha
  • Different Developmental Stages
2016
Aphis gossypii Elongation factor 1 alpha
  • Different Developmental Stages & Geographical Populations
2016
Arachis hypogaea Elongation factor 1B
  • Different Tissues
2013
Arachis hypogaea Elongation factor 1b
  • Different Developmental Stages & Abiotic Stress
2012
Artemisia annua Elongation factor 1-alpha
  • Different Tissues & Abiotic Stress
2014
Bemisia tabaci Elongation factor1-alpha
  • Different Commercially Available Insecticides
2014
Branchiostoma japonicum Elongation factor 1-alpha
  • Elongation factor 1-alpha
2012
Brassica oleracea Elongation factor 1-alpha
  • Abiotic Stresses
2014
Brassica rapa subsp. pekinensis Elongation-factor-1-α
  • Biotic Stress & Mycotic Infection
2010
Camellia sinensis Elongation factor 1 alpha
  • Various Experimental Treatments
2014
Caragana korshinskii Elongation factor 1-alpha-like
  • Abiotic Stress
2014
Chortoicetes terminifera Elongation factor 1 alpha
  • Density-Dependent Behavioural plasticity
2011
Cicer arietinum Elongation factor 1-alpha
  • Different Developmental Stages & Abiotic Stress
2010
Cichorium intybus Elongation factor 1-alpha
  • Different Tissues
2010
Coffea arabica L. Elongation factor 1, Elongation factor 1-alpha
  • Abiotic Stress
2013
Coffea arabica L. Elongation factor 1-alpha
  • Different Genotypes & Abiotic Stress
2012
Corchorus capsularis Elongation factor 1-alph
  • Different Tissues & Abiotic Stress
2015
Craterostigma plantagineum Elongation factor 1-alpha
  • Different Tissues
2015
Ctenopharyngodon idella Elongation factor 1 a
  • Tissues & Cell Culture
2011
Cucumis sativus Elongation factor 1-alpha
  • Various Nutrition Conditions
2013
Cucumis sativus Elongation factor 1-α
  • Different Tissues & Hormones Treatment & abiotic stresses
2010
Cynodon dactylon Elongation factor 1a
  • Abiotic Stress
2014
Danaus plexippus Elongation factor 1α
  • Biotic & Abiotic Stress
2015
Dendrocalamus latiflorus Elongation factor 1-alpha
  • Different Tissues & Ploidy
2014
Diabrotica virgifera virgifera elongation factor-1α
  • Different Developmental Stages & Tissues
2014
Dicentrarchus labrax Ef-1 alpha
  • Different Developmental Stages & Tissues
2009
Dimocarpus longan Eukaryotic elongation factor 1-alpha
  • Somatic Embryogenesis
2010
Diploptera punctata Elongation factor 1 alpha
  • During Gonadotrophic Cycle
2013
Drosophila melanogaster Elongation Factor 1 alpha100
  • Physiological Responses
2011
Eremosparton songoricum Elongation factor 1-alpha
  • Different Tissues & Abiotic Stress
2012
Eucalyptus globulus Elongation factor 1α
  • Cold Acclimation
2010
Fragaria ananassa Elongation factor 1-alpha
  • Different Developmental Stages & Tissues
2015
Gentiana macrophylla Elongation factor 1-alpha
  • Different Tissue Types & Abiotic Stress
2016
Gossypium hirsutum Translation elongation factor 1A-8
  • Abiotic Stress
2013
Haliotis discus hannai Elongation factor-1-а
  • Bacterial Infection
2013
Hippoglossus hippoglossus Elongation factor 1 alpha
  • Different Development & Tissues
2010
Homo sapiens Eukaryotic elongation factor 1A1
  • Myocardium
2008
Hyriopsis cumingii Elongation factor 1-alpha
  • During Biomineralization
2014
Jatropha curcas Elongation factor 1-alpha
  • Staminate & Pistillate Flowers
2017
Leptospira interrogans Eukaryotic translation elongation factor 1 alpha 2
  • Different Tissues & Abiotic Stress
2008
Lilium regale Elongation factor 1-a
  • Different Developmental Stages & Abiotic Stress
2016
Litsea cubeba Elongation factor 1-alpha
  • Different Developmental Stages & Tissues
2013
Lolium multiflorum Elongation factor 1-α-like protein
  • Salt Stress
2015
Lucilia sericata Elongation factor 1-alpha 1
  • Immune Challenge
2015
Lycium barbarum Elongation factor 1 alpha-like
  • Fruit Development
2013
Mus musculus Eukaryotic Translation Elongation Factor 2
  • Dextran Sodium Sulfate Experimental Colitis
2016
Musca domestica Elongation factor 1 alpha-like
  • Abiotic & Biotic Stress
2013
Nicotiana tabacum Elongation factor 1α
  • Different Developmental Stages & Abiotic stress
2010
Oreochromis niloticus EF-1a mRNA for elongation factor 1a
  • Different Tissues & Bacterial Infection
2013
Oreochromis niloticus Elongation factor 1 α
  • Vaccination & Infection
2015
Paeonia suffruticosa Elongation factor 1 alpha
  • Flower Development & Different Cultivars
2016
Panicum virgatum Elongation factor 1a
  • Different Tissues & Abiotic Stress
2014
Pecten maximus Eukaryotic translation elongation factor 1 alpha
  • Different Tissues
2012
Pennisetum glaucum Elongation factor-1 alpha
  • Abiotic Stress
2016
Pennisetum glaucum Elongation factor 1 subunit alpha
  • Different Tissues & Genotypes
2015
Pinus massoniana Elongation factor 1-beta
  • Different Tissues & Floral Organ Development & Abiotic Stress
2016
Plukenetia volubilis Elongation factor 1-alpha
  • Different Developmental Stages & Tissues
2015
Plutella xylostella Elongation factor 1
  • Different Developmental Stages & Tissues & Abiotic Stress
2013
Posidonia oceanica Elongation factor 1-alpha
  • Abiotic Stress
2012
Pyropia yezoensis Elongation factor 1-α
  • Different Developmental Stages & Abiotic Stress
2014
Ruditapes philippinarum Elongation factor 1 alpha
  • Copper Treated
2017
Salmo salar Elongation factor 1A A
  • Different Tissues & Smoltification Process
2005
Salmo salar Elongation factor 1A B
  • Different Tissues & Smoltification Process
2005
Scophthalmus maximus Elongation factor-1-α
  • Viral Infection
2013
Sebastes schlegeli Elongation factor-1-α
  • Different Developmental Stages & Tissues
2013
Setaria italica Elongation factor 1-alpha
  • Dehydration & Salinity Treatment
2013
Solanum tuberosum Elongation factor 1-a
  • Cold Stress
2013
Solenopsis invicta Translation elongation factor 1
  • Different Developmental Stages & Castes & Tissues
2013
Spodoptera litura Elongation factor-1
  • Abiotic & Biotic treatments
2013
Stipa grandis Elongation factor 1-beta
  • Abiotic Stress
2017
Tuber melanosporum Elongation factor 1-alpha
  • Different Developmental Stages
2015
Vernicia fordii Elongation factor 1-alpha
  • Seed Development
2012
Vigna mungo Elongation factor 1-alpha
  • Biotic and Abiotic stress
2013
Vitis vinifera Elongation factor 1a
  • Mycotic Infection
2013
Volvox carteri Eukaryotic translation elongation factor 1a2
  • Developmental Stages & Stress Treatments
2013
Zea mays Elongation factor 1 alpha
  • Abiotic Stresses & Hormone Treatment & Tissue Types
2014
Panax ginseng Elongation factor 1-gamma
  • Different Tissues & Abiotic Stress
2015
Corynebacterium pseudotuberculosis Elongation factor P
  • Abiotic Stress
2014
Glycine max Eukaryotic elongation factor 1 beta
  • Different Tissues & Abiotic Stress
2012
Glycine max Elongation factor 1-beta
  • Hypoxic Condition
2014
Panonychus citri Elongation factor-1 alpha
  • Different Developmental Stages & Abiotic Stress
2012
Raphanus sativus Translation elongation factor 2
  • Different Tissues & Cultivars & Developmental Stages
2012
Sesamia inferens Elongation factor 1
  • Different Tissues & Developmental Stages
2015
Spodoptera exigua Elongation factor 2
  • Different Developmental Stages & Tissues
2014

Featured Sequence

{DNA|

DNA =

000001 CTTTTTCGCA ACGGGTTTGC CGCCAGAACA CAGGTGTCGT GAAAACTACC CCTAAAAGCC AAAATGGGAA 000070
000071 AGGAAAAGAC TCATATCAAC ATTGTCGTCA TTGGACACGT AGATTCGGGC AAGTCCACCA CTACTGGCCA 000140
000141 TCTGATCTAT AAATGCGGTG GCATCGACAA AAGAACCATT GAAAAATTTG AGAAGGAGGC TGCTGAGATG 000210
000211 GGAAAGGGCT CCTTCAAGTA TGCCTGGGTC TTGGATAAAC TGAAAGCTGA GCGTGAACGT GGTATCACCA 000280
000281 TTGATATCTC CTTGTGGAAA TTTGAGACCA GCAAGTACTA TGTGACTATC ATTGATGCCC CAGGACACAG 000350
000351 AGACTTTATC AAAAACATGA TTACAGGGAC ATCTCAGGCT GACTGTGCTG TCCTGATTGT TGCTGCTGGT 000420
000421 GTTGGTGAAT TTGAAGCTGG TATCTCCAAG AATGGGCAGA CCCGAGAGCA TGCCCTTCTG GCTTACACAC 000490
000491 TGGGTGTGAA ACAACTAATT GTCGGTGTTA ACAAAATGGA TTCCACTGAG CCACCCTACA GCCAGAAGAG 000560
000561 ATATGAGGAA ATTGTTAAGG AAGTCAGCAC TTACATTAAG AAAATTGGCT ACAACCCCGA CACAGTAGCA 000630
000631 TTTGTGCCAA TTTCTGGTTG GAATGGTGAC AACATGCTGG AGCCAAGTGC TAACATGCCT TGGTTCAAGG 000700
000701 GATGGAAAGT CACCCGTAAG GATGGCAATG CCAGTGGAAC CACGCTGCTT GAGGCTCTGG ACTGCATCCT 000770
000771 ACCACCAACT CGTCCAACTG ACAAGCCCTT GCGCCTGCCT CTCCAGGATG TCTACAAAAT TGGTGGTATT 000840
000841 GGTACTGTTC CTGTTGGCCG AGTGGAGACT GGTGTTCTCA AACCCGGTAT GGTGGTCACC TTTGCTCCAG 000910
000911 TCAACGTTAC AACGGAAGTA AAATCTGTCG AAATGCACCA TGAAGCTTTG AGTGAAGCTC TTCCTGGGGA 000980
000981 CAATGTGGGC TTCAATGTCA AGAATGTGTC TGTCAAGGAT GTTCGTCGTG GCAACGTTGC TGGTGACAGC 001050
001051 AAAAATGACC CACCAATGGA AGCAGCTGGC TTCACTGCTC AGGTGATTAT CCTGAACCAT CCAGGCCAAA 001120
001121 TAAGCGCCGG CTATGCCCCT GTATTGGATT GCCACACGGC TCACATTGCA TGCAAGTTTG CTGAGCTGAA 001190
001191 GGAAAAGATT GATCGCCGTT CTGGTAAAAA GCTGGAAGAT GGCCCTAAAT TCTTGAAGTC TGGTGATGCT 001260
001261 GCCATTGTTG ATATGGTTCC TGGCAAGCCC ATGTGTGTTG AGAGCTTCTC AGACTATCCA CCTTTGGGTC 001330
001331 GCTTTGCTGT TCGTGATATG AGACAGACAG TTGCGGTGGG TGTCATCAAA GCAGTGGACA AGAAGGCTGC 001400
001401 TGGAGCTGGC AAGGTCACCA AGTCTGCCCA GAAAGCTCAG AAGGCTAAAT GAATATTATC CCTAATACCT 001470
001471 GCCACCCCAC TCTTAATCAG TGGTGGAAGA ACGGTCTCAG AACTGTTTGT TTCAATTGGC CATTTAAGTT 001540
001541 TAGTAGTAAA AGACTGGTTA ATGATAACAA TGCATCGTAA AACCTTCAGA AGGAAAGGAG AATGTTTTGT 001610
001611 GGACCACTTT GGTTTTCTTT TTTGCGTGTG GCAGTTTTAA GTTATTAGTT TTTAAAATCA GTACTTTTTA 001680
001681 ATGGAAACAA CTTGACCAAA AATTTGTCAC AGAATTTTGA GACCCATTAA AAAAGTTAAA TGAGAAACCT 001750
001751 GTGTGTTCCT TTGGTCAACA CCGAGACATT TAGGTGAAAG ACATCTAATT CTGGTTTTAC GAATCTGGAA 001820
001821 ACTTCTTGAA AATGTAATTC TTGAGTTAAC ACTTCTGGGT GGAGAATAGG GTTGTTTTCC CCCCACATAA 001890
001891 TTGGAAGGGG AAGGAATATC ATTTAAAGCT ATGGGAGGGT TGCTTTGATT ACAACACTGG AGAGAAATGC 001960
001961 AGCATGTTGC TGATTGCCTG TCACTAAAAC AGGCCAAAAA CTGAGTCCTT GTGTTGCATA GAAAGCTTCA 002030
002031 TGTTGCTAAA CCAATGTTAA GTGAATCTTT GGAAACAAAA TGTTTCCAAA TTACTGGGAT GTGCATGTTG 002100
002101 AAACGTGGGT TAAAATGACT GGGCAGTGAA AGTTGACTAT TTGCCATGAC ATAAGAAATA AGTGTAGTGG 002170
002171 CTAGTGTACA CCCTATGAGT GGAAGGGTCC ATTTTGAAGT CAGTGGAGTA AGCTTTATGC CAGTTTGATG 002240
002241 GTTTCACAAG TTCTATTGAG TGCTATTCAG AATAGGAACA AGGTTCTAAT AGAAAAAGAT GGCAATTTGA 002310
002311 AGTAGCTATA AAATTAGACT AATCTACATT GCTTTTCTCC TGCAGAGTCT AATACCTTTT ATGCTTTGAT 002380
002381 AATTAGCAGT TTGTCTACTT GGTCACTAGG AATGAAACTA CATGGTAATA GGCTTAACAG GTGTAATAGC 002450
002451 CCACTTACTC CTGAATCTTT AAGCATTTGT GCATTTGAAA AATGCTTTTC GCGATCTTCC TGCTGGGATT 002520
002521 ACAGGCATGA GCCACTGTGC CTGACCTCCC ATATGTAAAA GTGTCTAAAG GTTTTTTTTT GGTTATAAAA 002590
002591 GGAAAATTTT TGCTTAAGTT TGAAGGATAG GTAAAATTAA AGGACATGCT TTCTGTTTGT GTGATGGTTT 002660
002661 TTAAAAATTT TTTTTAAGAT GGAGTTCTTG TTGCCCAGGC TAGAATGCAA TGGCAAAATC TCACTGCAAT 002730
002731 CTCCTCCTCC TGGGTTCAAG CAATTCTCCT ACTTCAGCCT CCCAAGTAGC TGGGATTACA GGCATGTGCT 002800
002801 AATTTGGTGT TTTTAATAGA GATGAGGTTT TTCCATGTTG GTCAGGCTGG TCTCAAACTC CTGACCTTAG 002870
002871 GTGATCGCCT CGGCCTCCTA AAGTGCTGGA ATTACAGGCA TGAGCCACCA TGCCTGGCCA GGACATGTGT 002940
002941 TCTTAAGGAC ATGCTAAGCA GGAGTTAAAG CAGCCCAAGA GATAAGGCCT CTTAAAGTGA CTGGCAATGT 003010
003011 GTATTGCTCA AGATTCAAAG GTACTTGAAT TGGCCATAGA CAAGTCTGTA ATGAAGTGTT ATCGTTTTCC 003080
003081 CTCATCTGAG TCTGAATTAG ATAAAATGCC TTCCCATCAG CCAGTGCTCT GAGGTATCAA GTCTAAATTG 003150
003151 AACTAGAGAT TTTTGTCCTT AGTTTCTTTG CTATCTAATG TTTACACAAG TAAATAGTCT AAGATTTGCT 003220
003221 GGATGACAGA AAAAACAGGT AAGGCCTTTA ATAGATGGCC AATAGATGCC CTGATAATGA AAGTTGACAC 003290
003291 CTGTAAGATT TACCAGTAGA GAATTCTTGA CATGCAAGGA AGCAAGATTT AACTGAAAAA TTGTTCCCAC 003360
003361 TGGAAGCAGG AATGAGTCAG TTTACTTGCA TATACTGAGA TTGAGATTAA CTTCCTGTGA AACCCAGTGT 003430
003431 CTTAGACAAC TGTGGCTTGA GCACCACCTG CTGGTATTCA TTACAAACTT GCTCACTACA ATAAATGAAT 003500
003501 TTTAAGCTTT AAAAAAAAAA AAAAAAAA

|

SOURCE = |

}


External Links