Difference between revisions of "Gene:EIF"

From ICG
Jump to navigation Jump to search
(Created page with "==Family Symbol==")
 
 
(19 intermediate revisions by 2 users not shown)
Line 1: Line 1:
==Family Symbol==
+
=='''''Synonymous Genes'''''==
 +
* EIF <=> eIF1,IF4α,eIF4A-3,IF3G1
 +
 
 +
=='''''Applicable Species'''''==
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Species 
 +
! Gene Synonymous 
 +
! Application scenarios
 +
! Publication
 +
! Year
 +
|-
 +
|align="center"|[[Ammopiptanthus mongolicus]]
 +
|align="center"|Eukaryotic initiation factor
 +
||
 +
*''Abiotic Stresses''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22451089 Reference gene selection for qPCR in Ammopiptanthus mongolicus under abiotic stresses and expression analysis of seven ROS-scavenging enzyme genes]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Cajanus cajan]]
 +
|align="center"|Initiation factor 4a
 +
||
 +
*''Drought Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25849964 Evaluation and validation of housekeeping genes as reference for gene expression studies in pigeonpea (Cajanus cajan) under drought stress conditions]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Carica papaya]]
 +
|align="center"|Eukaryotic initiation factor 4A
 +
||
 +
*''Different Experimental Conditions''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22952972 Evaluation of new reference genes in papaya for accurate transcript normalization under different experimental conditions]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Elaeis guineensis]]
 +
|align="center"|Eukaryotic initiation factor 4A
 +
||
 +
*''Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24862192 Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Litsea cubeba]]
 +
|align="center"|Eukaryotic initiation factor 4-alpha
 +
||
 +
*''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24162560 Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Oryza sativa]]
 +
|align="center"|Eukaryotic initiation factor 4A-3
 +
||
 +
*''Anther Development''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24492537 Defining reference genes for quantitative real-time PCR analysis of anther development in rice]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Oryza sativa]]
 +
|align="center"|Eukaryotic initiation factor 4A-3
 +
||
 +
*''Seed Development''
 +
||
 +
*[https://link.springer.com/article/10.1007/s11105-009-0124-1 Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Panax ginseng]]
 +
|align="center"|Eukaryotic translation initiation factor 3G1
 +
||
 +
*''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26793228 Validation of Suitable Reference Genes for Quantitative Gene Expression Analysis in Panax ginseng]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Panicum virgatum]]
 +
|align="center"|Eukaryotic initiation factor 4a
 +
||
 +
*''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24621568 Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Pennisetum glaucum]]
 +
|align="center"|Eukaryotic initiation factor 4A
 +
||
 +
*''Different Tissues & Genotypes''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S2352407315000062 Cloning and validation of reference genes for normalization of gene expression studies in pearl millet (Pennisetum glaucum (L.) R. Br.) by quantitative real-time PCR]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Pyropia yezoensis]]
 +
|align="center"|Translation initiation factor 4A
 +
||
 +
*''Different Developmental Stages & Abiotic Stress''
 +
||
 +
*[https://link.springer.com/article/10.1007/s10811-014-0359-6 Selection of reference genes for gene expression normalization in Pyropia yezoensis using quantitative real-time PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Sorghum bicolor]]
 +
|align="center"|Eukaryotic Initiation Factor 4A
 +
||
 +
*''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/27200008 Evaluation of Sorghum Sorghum bicolor (L.) Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Brachiaria brizantha]]
 +
|align="center"|Eukaryotic initiation factor 4A
 +
||
 +
*''Different Sex & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23427655 Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Craterostigma plantagineum]]
 +
|align="center"|Elongation factor 1-alpha
 +
||
 +
*''Different Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26025524 Quantification of expression of dehydrin isoforms in the desiccation tolerant plant Craterostigma plantagineum using specifically designed reference genes]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Litsea cubeba]]
 +
|align="center"|Eukaryotic initiation factor 4-alpha
 +
||
 +
*''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24162560 Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Panicum virgatum]]
 +
|align="center"|Eukaryotic initiation factor 4a
 +
||
 +
*''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24621568 Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Pennisetum glaucum]]
 +
|align="center"|Eukaryotic initiation factor 4A
 +
||
 +
*''Different Tissues & Genotypes''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S2352407315000062 Cloning and validation of reference genes for normalization of gene expression studies in pearl millet Pennisetum glaucum (L.) R. Br. by quantitative real-time PCR]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Pyropia yezoensis]]
 +
|align="center"|Translation initiation factor 4A
 +
||
 +
*''Different Developmental Stages & Abiotic Stress''
 +
||
 +
*[https://link.springer.com/article/10.1007/s10811-014-0359-6 Selection of reference genes for gene expression normalization in Pyropia yezoensis using quantitative real-time PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Bombyx mori]]
 +
|align="center"| Translation initiation factor 4A
 +
||
 +
*''Different Developmental Stages''
 +
||
 +
*[http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7917.2008.00227.x/full Reference genes identified in the silkworm Bombyx moil during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR]
 +
|align="center"|2008
 +
|-
 +
|align="center"|[[Bombyx mori]]
 +
|align="center"| Translation initiation factor 3 subunit 4
 +
||
 +
*''Different Developmental Stages''
 +
||
 +
*[http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7917.2008.00227.x/full Reference genes identified in the silkworm Bombyx moil during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR]
 +
|align="center"|2008
 +
|-
 +
|align="center"|[[Bombyx mori]]
 +
|align="center"| Translation initiation factor 3 subunit 5
 +
||
 +
*''Different Developmental Stages''
 +
||
 +
*[http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7917.2008.00227.x/full Reference genes identified in the silkworm Bombyx moil during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR]
 +
|align="center"|2008
 +
|}
 +
 
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>ATGGCGGCGGCCACCACGTCGCGGCGCGGCCCGGGCGCCATGGACGACGAGAACCTCACC
 +
TTCGAGACCTCCCCGGGGGTCGAGGTCATCAGCAGCTTCGACCAGATGGGGATCCGCGAC
 +
GACCTCCTCCGCGGCATCTACGCCTACGGCTTCGAGAAGCCCTCCGCCATCCAGCAGCGC
 +
GCCGTCCTCCCCATCATCAGCGGCCGCGACGTCATCGCCCAGGCCCAGTCCGGGACCGGC
 +
AAGACCTCCATGATCTCGCTCTCCGTCTGCCAGATCGTAGACACCGCCGTCCGTGAGGTG
 +
CAGGCTTTAATACTGTCACCAACTAGAGAACTTGCTGCACAAACAGAAAGAGTTATGCTG
 +
GCTATCGGTGACTTCATCAATATCCAAGTGCATGCTTGTATTGGTGGCAAAAGTATTGGT
 +
GAGGATATTAGAAAGCTTGAGCACGGAGTGCATGTGGTGTCAGGAACACCTGGCAGAGTC
 +
TGTGATATGATCAAGAGAAGGACCTTGCGTACAAGAGCCATTAAGCTCCTAATTCTGGAT
 +
GAAGCTGATGAGATGTTGGGCAGAGGCTTTAAGGATCAGATATATGATGTGTACAGATAC
 +
CTCCCTCCAGAACTCCAGGTTTGCTTGATCTCCGCAACTCTGCCTCACGAGATCTTGGAA
 +
ATGACCAGCAAGTTCATGACTGATCCAGTTCGGATCCTTGTGAAGCGTGATGAATTGACT
 +
CTAGAGGGCATCAAACAATTCTTTGTTGCTGTTGAGAAAGAAGAATGGAAGTTTGACACG
 +
CTTTGTGATCTTTATGATACACTGACAATCACCCAAGCTGTCATTTTCTGCAACACAAAG
 +
AGAAAGGTTGATTGGCTTACGGAAAGAATGCGCAGCAATAACTTCACAGTATCAGCTATG
 +
CATGGCGACATGCCTCAAAAGGAAAGGGATGCCATTATGGGTGAATTCAGGTCTGGTGCA
 +
ACCCGTGTTCTAATCACGACAGATGTGTGGGCTCGAGGCCTCGATGTTCAGCAGGTCTCT
 +
CTTGTCATAAATTATGATCTCCCAAATAATCGTGAACTTTACATCCATCGCATTGGTCGC
 +
TCTGGACGTTTTGGTCGCAAGGGTGTGGCCATCAATTTTGTCAAAAAGGAAGACATCCGT
 +
ATCCTGAGAGATATCGAGCAGTACTACAGCACGCAGATTGATGAAATGCCAATGAATGTT
 +
GCTGATCTAATTTGA</dnaseqindica>|
 +
SOURCE = '''''Oryza sativa''''' eIF4A-3|
 +
}}
 +
 
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = SOURCE = '''''Oryza sativa''''' eIF4A-3||
 +
Str= [[File:eif_1.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:EIF]]|
 +
}}
 +
 
 +
=='''''External Links'''''==
 +
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=cd00268 NCBI Conserved Protein Domain Family]
 +
* [https://en.wikipedia.org/wiki/Eukaryotic_initiation_factor WikiPedia]
 +
* [http://pfam.xfam.org/family/PF01652 Pfam]

Latest revision as of 02:18, 30 August 2017

Synonymous Genes

  • EIF <=> eIF1,IF4α,eIF4A-3,IF3G1

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Ammopiptanthus mongolicus Eukaryotic initiation factor
  • Abiotic Stresses
2012
Cajanus cajan Initiation factor 4a
  • Drought Stress
2015
Carica papaya Eukaryotic initiation factor 4A
  • Different Experimental Conditions
2012
Elaeis guineensis Eukaryotic initiation factor 4A
  • Abiotic Stress
2014
Litsea cubeba Eukaryotic initiation factor 4-alpha
  • Different Developmental Stages & Tissues
2013
Oryza sativa Eukaryotic initiation factor 4A-3
  • Anther Development
2014
Oryza sativa Eukaryotic initiation factor 4A-3
  • Seed Development
2010
Panax ginseng Eukaryotic translation initiation factor 3G1
  • Different Tissues & Abiotic Stress
2015
Panicum virgatum Eukaryotic initiation factor 4a
  • Different Tissues & Abiotic Stress
2014
Pennisetum glaucum Eukaryotic initiation factor 4A
  • Different Tissues & Genotypes
2015
Pyropia yezoensis Translation initiation factor 4A
  • Different Developmental Stages & Abiotic Stress
2014
Sorghum bicolor Eukaryotic Initiation Factor 4A
  • Different Tissues & Abiotic Stress
2016
Brachiaria brizantha Eukaryotic initiation factor 4A
  • Different Sex & Tissues
2013
Craterostigma plantagineum Elongation factor 1-alpha
  • Different Tissues
2015
Litsea cubeba Eukaryotic initiation factor 4-alpha
  • Different Developmental Stages & Tissues
2013
Panicum virgatum Eukaryotic initiation factor 4a
  • Different Tissues & Abiotic Stress
2014
Pennisetum glaucum Eukaryotic initiation factor 4A
  • Different Tissues & Genotypes
2015
Pyropia yezoensis Translation initiation factor 4A
  • Different Developmental Stages & Abiotic Stress
2014
Bombyx mori Translation initiation factor 4A
  • Different Developmental Stages
2008
Bombyx mori Translation initiation factor 3 subunit 4
  • Different Developmental Stages
2008
Bombyx mori Translation initiation factor 3 subunit 5
  • Different Developmental Stages
2008

Featured Sequence

The Sequence of Oryza sativa eIF4A-3 is displayed as example.

000001 ATGGCGGCGG CCACCACGTC GCGGCGCGGC CCGGGCGCCA TGGACGACGA GAACCTCACC TTCGAGACCT 000070
000071 CCCCGGGGGT CGAGGTCATC AGCAGCTTCG ACCAGATGGG GATCCGCGAC GACCTCCTCC GCGGCATCTA 000140
000141 CGCCTACGGC TTCGAGAAGC CCTCCGCCAT CCAGCAGCGC GCCGTCCTCC CCATCATCAG CGGCCGCGAC 000210
000211 GTCATCGCCC AGGCCCAGTC CGGGACCGGC AAGACCTCCA TGATCTCGCT CTCCGTCTGC CAGATCGTAG 000280
000281 ACACCGCCGT CCGTGAGGTG CAGGCTTTAA TACTGTCACC AACTAGAGAA CTTGCTGCAC AAACAGAAAG 000350
000351 AGTTATGCTG GCTATCGGTG ACTTCATCAA TATCCAAGTG CATGCTTGTA TTGGTGGCAA AAGTATTGGT 000420
000421 GAGGATATTA GAAAGCTTGA GCACGGAGTG CATGTGGTGT CAGGAACACC TGGCAGAGTC TGTGATATGA 000490
000491 TCAAGAGAAG GACCTTGCGT ACAAGAGCCA TTAAGCTCCT AATTCTGGAT GAAGCTGATG AGATGTTGGG 000560
000561 CAGAGGCTTT AAGGATCAGA TATATGATGT GTACAGATAC CTCCCTCCAG AACTCCAGGT TTGCTTGATC 000630
000631 TCCGCAACTC TGCCTCACGA GATCTTGGAA ATGACCAGCA AGTTCATGAC TGATCCAGTT CGGATCCTTG 000700
000701 TGAAGCGTGA TGAATTGACT CTAGAGGGCA TCAAACAATT CTTTGTTGCT GTTGAGAAAG AAGAATGGAA 000770
000771 GTTTGACACG CTTTGTGATC TTTATGATAC ACTGACAATC ACCCAAGCTG TCATTTTCTG CAACACAAAG 000840
000841 AGAAAGGTTG ATTGGCTTAC GGAAAGAATG CGCAGCAATA ACTTCACAGT ATCAGCTATG CATGGCGACA 000910
000911 TGCCTCAAAA GGAAAGGGAT GCCATTATGG GTGAATTCAG GTCTGGTGCA ACCCGTGTTC TAATCACGAC 000980
000981 AGATGTGTGG GCTCGAGGCC TCGATGTTCA GCAGGTCTCT CTTGTCATAA ATTATGATCT CCCAAATAAT 001050
001051 CGTGAACTTT ACATCCATCG CATTGGTCGC TCTGGACGTT TTGGTCGCAA GGGTGTGGCC ATCAATTTTG 001120
001121 TCAAAAAGGA AGACATCCGT ATCCTGAGAG ATATCGAGCA GTACTACAGC ACGCAGATTG ATGAAATGCC 001190
001191 AATGAATGTT GCTGATCTAA TTTGA

Conserved Domains

The Conserved domains of SOURCE = Oryza sativa eIF4A-3 is displayed as example.

Eif 1.png

External Links