Difference between revisions of "Gene:EIF"

From ICG
Jump to navigation Jump to search
 
(18 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* EIF <=> eIF1,IF4α,eIF4A-3,IF3G1
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 10: Line 11:
 
! Year
 
! Year
 
|-
 
|-
|align="center"|[[Arachis hypogaea]]
+
|align="center"|[[Ammopiptanthus mongolicus]]
|align="center"|Elongation factor 1B
+
|align="center"|Eukaryotic initiation factor  
 
||
 
||
*''Different Tissues''
+
*''Abiotic Stresses''
||
 
*[https://www.ncbi.nlm.nih.gov/pubmed/24167633 Evaluation and validation of reference genes for normalization of quantitative real-time PCR based gene expression studies in peanut]
 
|align="center"|2013
 
|-
 
|align="center"|[[Arachis hypogaea]]
 
|align="center"|Elongation factor 1b
 
 
||
 
||
*''Different Developmental Stages & Abiotic Stress''
+
*[https://www.ncbi.nlm.nih.gov/pubmed/22451089 Reference gene selection for qPCR in Ammopiptanthus mongolicus under abiotic stresses and expression analysis of seven ROS-scavenging enzyme genes]
||
 
*[https://www.ncbi.nlm.nih.gov/pubmed/22203160 Validation of reference genes for gene expression studies in peanut by quantitative real-time RT-PCR]
 
 
|align="center"|2012
 
|align="center"|2012
 
|-
 
|-
Line 41: Line 34:
 
*[https://www.ncbi.nlm.nih.gov/pubmed/22952972 Evaluation of new reference genes in papaya for accurate transcript normalization under different experimental conditions]
 
*[https://www.ncbi.nlm.nih.gov/pubmed/22952972 Evaluation of new reference genes in papaya for accurate transcript normalization under different experimental conditions]
 
|align="center"|2012
 
|align="center"|2012
|-
 
|align="center"|[[Corynebacterium pseudotuberculosis]]
 
|align="center"|Elongation factor P
 
||
 
*''Abiotic Stress''
 
||
 
*[https://www.ncbi.nlm.nih.gov/pubmed/25017489 Reference genes for RT-qPCR studies in Corynebacterium pseudotuberculosis identified through analysis of RNA-seq data]
 
|align="center"|2014
 
|-
 
|align="center"|[[Craterostigma plantagineum]]
 
|align="center"|Eukaryotic initiation factor 5A
 
||
 
*''Different Tissues''
 
||
 
*[https://www.ncbi.nlm.nih.gov/pubmed/26025524 Quantification of expression of dehydrin isoforms in the desiccation tolerant plant Craterostigma plantagineum using specifically designed reference genes]
 
|align="center"|2015
 
 
|-
 
|-
 
|align="center"|[[Elaeis guineensis]]
 
|align="center"|[[Elaeis guineensis]]
|align="center"|Eukaryotic initiation factor 4A, Eukaryotic initiation factor 4A
+
|align="center"|Eukaryotic initiation factor 4A
 
||
 
||
 
*''Abiotic Stress''
 
*''Abiotic Stress''
 
||
 
||
 
*[https://www.ncbi.nlm.nih.gov/pubmed/24862192 Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR]
 
*[https://www.ncbi.nlm.nih.gov/pubmed/24862192 Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR]
|align="center"|2014
 
|-
 
|align="center"|[[Glycine max]]
 
|align="center"|Eukaryotic elongation factor 1 beta
 
||
 
*''Different Tissues & Abiotic Stress''
 
||
 
*[https://www.ncbi.nlm.nih.gov/pubmed/23029532 Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions]
 
|align="center"|2012
 
|-
 
|align="center"|[[Glycine max]]
 
|align="center"|Elongation factor 1-beta
 
||
 
*''Hypoxic Condition''
 
||
 
*[https://www.ncbi.nlm.nih.gov/pubmed/24615050 Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions]
 
 
|align="center"|2014
 
|align="center"|2014
 
|-
 
|-
Line 121: Line 82:
 
*[https://www.ncbi.nlm.nih.gov/pubmed/24621568 Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR]
 
*[https://www.ncbi.nlm.nih.gov/pubmed/24621568 Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR]
 
|align="center"|2014
 
|align="center"|2014
|-
 
|align="center"|[[Panonychus citri]]
 
|align="center"|Elongation factor-1 alpha
 
||
 
*''Different Developmental Stages & Abiotic Stress''
 
||
 
*[https://www.ncbi.nlm.nih.gov/pubmed/22203483 Evaluation of suitable reference genes for quantitative RT-PCR during development and abiotic stress in Panonychus citri (McGregor)(Acari: Tetranychidae)]
 
|align="center"|2012
 
 
|-
 
|-
 
|align="center"|[[Pennisetum glaucum]]
 
|align="center"|[[Pennisetum glaucum]]
Line 135: Line 88:
 
*''Different Tissues & Genotypes''
 
*''Different Tissues & Genotypes''
 
||
 
||
*[http://www.sciencedirect.com/science/article/pii/S2352407315000062 Cloning and validation of reference genes for normalization of gene expression studies in pearl millet [Pennisetum glaucum (L.) R. Br.] by quantitative real-time PCR]
+
*[http://www.sciencedirect.com/science/article/pii/S2352407315000062 Cloning and validation of reference genes for normalization of gene expression studies in pearl millet (Pennisetum glaucum (L.) R. Br.) by quantitative real-time PCR]
 
|align="center"|2015
 
|align="center"|2015
 
|-
 
|-
Line 146: Line 99:
 
|align="center"|2014
 
|align="center"|2014
 
|-
 
|-
|align="center"|[[Raphanus sativus]]
+
|align="center"|[[Sorghum bicolor]]
|align="center"|Translation elongation factor 2
+
|align="center"|Eukaryotic Initiation Factor 4A
 
||
 
||
*''Different Tissues & Cultivars & Developmental Stages''
+
*''Different Tissues & Abiotic Stress''
 
||
 
||
*[https://www.ncbi.nlm.nih.gov/pubmed/22771808 Evaluation of reference genes for gene expression studies in radish (Raphanus sativus L.) using quantitative real-time PCR]
+
*[https://www.ncbi.nlm.nih.gov/pubmed/27200008 Evaluation of Sorghum Sorghum bicolor (L.) Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization]
|align="center"|2012
+
|align="center"|2016
 
|-
 
|-
|align="center"|[[Saccharomyces cerevisiae]]
+
|align="center"|[[Brachiaria brizantha]]
|align="center"|TATA-box binding protein associated factor 10 
+
|align="center"|Eukaryotic initiation factor 4A
 
||
 
||
*''Various Physiological States''
+
*''Different Sex & Tissues''
 
||
 
||
*[https://www.ncbi.nlm.nih.gov/pubmed/19874630 Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae]
+
*[https://www.ncbi.nlm.nih.gov/pubmed/23427655 Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)]
|align="center"|2009
+
|align="center"|2013
 
|-
 
|-
|align="center"|[[Sesamia inferens]]
+
|align="center"|[[Craterostigma plantagineum]]
|align="center"|Elongation factor 1  
+
|align="center"|Elongation factor 1-alpha
 
||
 
||
*''Different Tissues & Developmental Stages''
+
*''Different Tissues''
 
||
 
||
*[https://www.ncbi.nlm.nih.gov/pubmed/25585250 Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae)]
+
*[https://www.ncbi.nlm.nih.gov/pubmed/26025524 Quantification of expression of dehydrin isoforms in the desiccation tolerant plant Craterostigma plantagineum using specifically designed reference genes]
 
|align="center"|2015
 
|align="center"|2015
 
|-
 
|-
|align="center"|[[Sorghum bicolor]]
+
|align="center"|[[Litsea cubeba]]
|align="center"|Eukaryotic Initiation Factor 4A
+
|align="center"|Eukaryotic initiation factor 4-alpha
 +
||
 +
*''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24162560 Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Panicum virgatum]]
 +
|align="center"|Eukaryotic initiation factor 4a
 
||
 
||
 
*''Different Tissues & Abiotic Stress''
 
*''Different Tissues & Abiotic Stress''
 
||
 
||
*[https://www.ncbi.nlm.nih.gov/pubmed/27200008 Evaluation of Sorghum Sorghum bicolor (L.) Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization]
+
*[https://www.ncbi.nlm.nih.gov/pubmed/24621568 Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR]
|align="center"|2016
+
|align="center"|2014
 +
|-
 +
|align="center"|[[Pennisetum glaucum]]
 +
|align="center"|Eukaryotic initiation factor 4A
 +
||
 +
*''Different Tissues & Genotypes''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S2352407315000062 Cloning and validation of reference genes for normalization of gene expression studies in pearl millet Pennisetum glaucum (L.) R. Br. by quantitative real-time PCR]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Pyropia yezoensis]]
 +
|align="center"|Translation initiation factor 4A
 +
||
 +
*''Different Developmental Stages & Abiotic Stress''
 +
||
 +
*[https://link.springer.com/article/10.1007/s10811-014-0359-6 Selection of reference genes for gene expression normalization in Pyropia yezoensis using quantitative real-time PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Bombyx mori]]
 +
|align="center"| Translation initiation factor 4A
 +
||
 +
*''Different Developmental Stages''
 +
||
 +
*[http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7917.2008.00227.x/full Reference genes identified in the silkworm Bombyx moil during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR]
 +
|align="center"|2008
 +
|-
 +
|align="center"|[[Bombyx mori]]
 +
|align="center"| Translation initiation factor 3 subunit 4
 +
||
 +
*''Different Developmental Stages''
 +
||
 +
*[http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7917.2008.00227.x/full Reference genes identified in the silkworm Bombyx moil during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR]
 +
|align="center"|2008
 +
|-
 +
|align="center"|[[Bombyx mori]]
 +
|align="center"| Translation initiation factor 3 subunit 5
 +
||
 +
*''Different Developmental Stages''
 +
||
 +
*[http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7917.2008.00227.x/full Reference genes identified in the silkworm Bombyx moil during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR]
 +
|align="center"|2008
 +
|}
 +
 
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>ATGGCGGCGGCCACCACGTCGCGGCGCGGCCCGGGCGCCATGGACGACGAGAACCTCACC
 +
TTCGAGACCTCCCCGGGGGTCGAGGTCATCAGCAGCTTCGACCAGATGGGGATCCGCGAC
 +
GACCTCCTCCGCGGCATCTACGCCTACGGCTTCGAGAAGCCCTCCGCCATCCAGCAGCGC
 +
GCCGTCCTCCCCATCATCAGCGGCCGCGACGTCATCGCCCAGGCCCAGTCCGGGACCGGC
 +
AAGACCTCCATGATCTCGCTCTCCGTCTGCCAGATCGTAGACACCGCCGTCCGTGAGGTG
 +
CAGGCTTTAATACTGTCACCAACTAGAGAACTTGCTGCACAAACAGAAAGAGTTATGCTG
 +
GCTATCGGTGACTTCATCAATATCCAAGTGCATGCTTGTATTGGTGGCAAAAGTATTGGT
 +
GAGGATATTAGAAAGCTTGAGCACGGAGTGCATGTGGTGTCAGGAACACCTGGCAGAGTC
 +
TGTGATATGATCAAGAGAAGGACCTTGCGTACAAGAGCCATTAAGCTCCTAATTCTGGAT
 +
GAAGCTGATGAGATGTTGGGCAGAGGCTTTAAGGATCAGATATATGATGTGTACAGATAC
 +
CTCCCTCCAGAACTCCAGGTTTGCTTGATCTCCGCAACTCTGCCTCACGAGATCTTGGAA
 +
ATGACCAGCAAGTTCATGACTGATCCAGTTCGGATCCTTGTGAAGCGTGATGAATTGACT
 +
CTAGAGGGCATCAAACAATTCTTTGTTGCTGTTGAGAAAGAAGAATGGAAGTTTGACACG
 +
CTTTGTGATCTTTATGATACACTGACAATCACCCAAGCTGTCATTTTCTGCAACACAAAG
 +
AGAAAGGTTGATTGGCTTACGGAAAGAATGCGCAGCAATAACTTCACAGTATCAGCTATG
 +
CATGGCGACATGCCTCAAAAGGAAAGGGATGCCATTATGGGTGAATTCAGGTCTGGTGCA
 +
ACCCGTGTTCTAATCACGACAGATGTGTGGGCTCGAGGCCTCGATGTTCAGCAGGTCTCT
 +
CTTGTCATAAATTATGATCTCCCAAATAATCGTGAACTTTACATCCATCGCATTGGTCGC
 +
TCTGGACGTTTTGGTCGCAAGGGTGTGGCCATCAATTTTGTCAAAAAGGAAGACATCCGT
 +
ATCCTGAGAGATATCGAGCAGTACTACAGCACGCAGATTGATGAAATGCCAATGAATGTT
 +
GCTGATCTAATTTGA</dnaseqindica>|
 +
SOURCE = '''''Oryza sativa''''' eIF4A-3|
 +
}}
  
|}
+
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = SOURCE = '''''Oryza sativa''''' eIF4A-3||
 +
Str= [[File:eif_1.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:EIF]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
+
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=cd00268 NCBI Conserved Protein Domain Family]
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
+
* [https://en.wikipedia.org/wiki/Eukaryotic_initiation_factor WikiPedia]
* [http://pfam.xfam.org/family/SAND Pfam]
+
* [http://pfam.xfam.org/family/PF01652 Pfam]

Latest revision as of 02:18, 30 August 2017

Synonymous Genes

  • EIF <=> eIF1,IF4α,eIF4A-3,IF3G1

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Ammopiptanthus mongolicus Eukaryotic initiation factor
  • Abiotic Stresses
2012
Cajanus cajan Initiation factor 4a
  • Drought Stress
2015
Carica papaya Eukaryotic initiation factor 4A
  • Different Experimental Conditions
2012
Elaeis guineensis Eukaryotic initiation factor 4A
  • Abiotic Stress
2014
Litsea cubeba Eukaryotic initiation factor 4-alpha
  • Different Developmental Stages & Tissues
2013
Oryza sativa Eukaryotic initiation factor 4A-3
  • Anther Development
2014
Oryza sativa Eukaryotic initiation factor 4A-3
  • Seed Development
2010
Panax ginseng Eukaryotic translation initiation factor 3G1
  • Different Tissues & Abiotic Stress
2015
Panicum virgatum Eukaryotic initiation factor 4a
  • Different Tissues & Abiotic Stress
2014
Pennisetum glaucum Eukaryotic initiation factor 4A
  • Different Tissues & Genotypes
2015
Pyropia yezoensis Translation initiation factor 4A
  • Different Developmental Stages & Abiotic Stress
2014
Sorghum bicolor Eukaryotic Initiation Factor 4A
  • Different Tissues & Abiotic Stress
2016
Brachiaria brizantha Eukaryotic initiation factor 4A
  • Different Sex & Tissues
2013
Craterostigma plantagineum Elongation factor 1-alpha
  • Different Tissues
2015
Litsea cubeba Eukaryotic initiation factor 4-alpha
  • Different Developmental Stages & Tissues
2013
Panicum virgatum Eukaryotic initiation factor 4a
  • Different Tissues & Abiotic Stress
2014
Pennisetum glaucum Eukaryotic initiation factor 4A
  • Different Tissues & Genotypes
2015
Pyropia yezoensis Translation initiation factor 4A
  • Different Developmental Stages & Abiotic Stress
2014
Bombyx mori Translation initiation factor 4A
  • Different Developmental Stages
2008
Bombyx mori Translation initiation factor 3 subunit 4
  • Different Developmental Stages
2008
Bombyx mori Translation initiation factor 3 subunit 5
  • Different Developmental Stages
2008

Featured Sequence

The Sequence of Oryza sativa eIF4A-3 is displayed as example.

000001 ATGGCGGCGG CCACCACGTC GCGGCGCGGC CCGGGCGCCA TGGACGACGA GAACCTCACC TTCGAGACCT 000070
000071 CCCCGGGGGT CGAGGTCATC AGCAGCTTCG ACCAGATGGG GATCCGCGAC GACCTCCTCC GCGGCATCTA 000140
000141 CGCCTACGGC TTCGAGAAGC CCTCCGCCAT CCAGCAGCGC GCCGTCCTCC CCATCATCAG CGGCCGCGAC 000210
000211 GTCATCGCCC AGGCCCAGTC CGGGACCGGC AAGACCTCCA TGATCTCGCT CTCCGTCTGC CAGATCGTAG 000280
000281 ACACCGCCGT CCGTGAGGTG CAGGCTTTAA TACTGTCACC AACTAGAGAA CTTGCTGCAC AAACAGAAAG 000350
000351 AGTTATGCTG GCTATCGGTG ACTTCATCAA TATCCAAGTG CATGCTTGTA TTGGTGGCAA AAGTATTGGT 000420
000421 GAGGATATTA GAAAGCTTGA GCACGGAGTG CATGTGGTGT CAGGAACACC TGGCAGAGTC TGTGATATGA 000490
000491 TCAAGAGAAG GACCTTGCGT ACAAGAGCCA TTAAGCTCCT AATTCTGGAT GAAGCTGATG AGATGTTGGG 000560
000561 CAGAGGCTTT AAGGATCAGA TATATGATGT GTACAGATAC CTCCCTCCAG AACTCCAGGT TTGCTTGATC 000630
000631 TCCGCAACTC TGCCTCACGA GATCTTGGAA ATGACCAGCA AGTTCATGAC TGATCCAGTT CGGATCCTTG 000700
000701 TGAAGCGTGA TGAATTGACT CTAGAGGGCA TCAAACAATT CTTTGTTGCT GTTGAGAAAG AAGAATGGAA 000770
000771 GTTTGACACG CTTTGTGATC TTTATGATAC ACTGACAATC ACCCAAGCTG TCATTTTCTG CAACACAAAG 000840
000841 AGAAAGGTTG ATTGGCTTAC GGAAAGAATG CGCAGCAATA ACTTCACAGT ATCAGCTATG CATGGCGACA 000910
000911 TGCCTCAAAA GGAAAGGGAT GCCATTATGG GTGAATTCAG GTCTGGTGCA ACCCGTGTTC TAATCACGAC 000980
000981 AGATGTGTGG GCTCGAGGCC TCGATGTTCA GCAGGTCTCT CTTGTCATAA ATTATGATCT CCCAAATAAT 001050
001051 CGTGAACTTT ACATCCATCG CATTGGTCGC TCTGGACGTT TTGGTCGCAA GGGTGTGGCC ATCAATTTTG 001120
001121 TCAAAAAGGA AGACATCCGT ATCCTGAGAG ATATCGAGCA GTACTACAGC ACGCAGATTG ATGAAATGCC 001190
001191 AATGAATGTT GCTGATCTAA TTTGA

Conserved Domains

The Conserved domains of SOURCE = Oryza sativa eIF4A-3 is displayed as example.

Eif 1.png

External Links