Difference between revisions of "Gene:EIF"

From ICG
Jump to navigation Jump to search
 
(4 intermediate revisions by one other user not shown)
Line 2: Line 2:
 
* EIF <=> eIF1,IF4α,eIF4A-3,IF3G1
 
* EIF <=> eIF1,IF4α,eIF4A-3,IF3G1
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 182: Line 182:
 
=='''Featured Sequence'''==
 
=='''Featured Sequence'''==
 
{{DNA|
 
{{DNA|
DNA = <dnaseqindica>GGAGCCAACGGCGGCTGTTTCACAGCAGATTTGATCGTAAAAGGAGGGAACAAGCTCTCACTGTGAAGCC
+
DNA = <dnaseqindica>ATGGCGGCGGCCACCACGTCGCGGCGCGGCCCGGGCGCCATGGACGACGAGAACCTCACC
ATGGCTCTGATTTTGCATGCGGGGAACCCAAATAAAAATGCTTGGAAGGCACTCATAGCGGCAGAATACA
+
TTCGAGACCTCCCCGGGGGTCGAGGTCATCAGCAGCTTCGACCAGATGGGGATCCGCGAC
GTGGTGTGAAAGTTGAACTGGTCAAGGATTTTCAGATGGGTGTATCGAACAAAACGCCAGAGTTTCTCAA
+
GACCTCCTCCGCGGCATCTACGCCTACGGCTTCGAGAAGCCCTCCGCCATCCAGCAGCGC
AATGAACCCTATGGGGAAGGTTCCAGTGCTTGAAACACCTGATGGTACTGTTTTTGAGAGTAATGCCATA
+
GCCGTCCTCCCCATCATCAGCGGCCGCGACGTCATCGCCCAGGCCCAGTCCGGGACCGGC
GCACGTTATGTTGCTCGTGTGAAGCCTGATAATTCCCTTTTTGGATCTTCGCTGATTGATTATGCCCACA
+
AAGACCTCCATGATCTCGCTCTCCGTCTGCCAGATCGTAGACACCGCCGTCCGTGAGGTG
TTGAGCAATGGATTGATTTTGCATCGTTGGAGATTGATGCCAATATTGCGCGATGGTTATATCCACGAAT
+
CAGGCTTTAATACTGTCACCAACTAGAGAACTTGCTGCACAAACAGAAAGAGTTATGCTG
GGGTTTTGCTATTTACCTTCCTCCGGCGGAAGAAGCTGCAATCGCATTAAAGAGAGCACTAGGAGCTTTA
+
GCTATCGGTGACTTCATCAATATCCAAGTGCATGCTTGTATTGGTGGCAAAAGTATTGGT
AATACCCATCTTGTTTCCAACACTTACTTGGTTGGGCATTCCGTCACTCTGGCTGATATTATTATGACAT
+
GAGGATATTAGAAAGCTTGAGCACGGAGTGCATGTGGTGTCAGGAACACCTGGCAGAGTC
GCAACTTGGCTTTGGGATTTAATCGAATTTTGACCAAGAGCTTTACCACAGAATTTCCACACGTAGAGAG
+
TGTGATATGATCAAGAGAAGGACCTTGCGTACAAGAGCCATTAAGCTCCTAATTCTGGAT
ATATTTTTGGACCATGATTAATCAACCAAACTTCTCCAAGATATTGGGTGAGCTCAAACAAGCAGATTCT
+
GAAGCTGATGAGATGTTGGGCAGAGGCTTTAAGGATCAGATATATGATGTGTACAGATAC
GTACCACCTGTTCAGTCAGTGAAGAAGCCCGCACAACCTAAGGAACCTGCAAAATCTAAGGTTCAGGATG
+
CTCCCTCCAGAACTCCAGGTTTGCTTGATCTCCGCAACTCTGCCTCACGAGATCTTGGAA
AACCTAAGAAAGAGGC</dnaseqindica>|
+
ATGACCAGCAAGTTCATGACTGATCCAGTTCGGATCCTTGTGAAGCGTGATGAATTGACT
SOURCE = '''''Panax ginseng''''' EIF|
+
CTAGAGGGCATCAAACAATTCTTTGTTGCTGTTGAGAAAGAAGAATGGAAGTTTGACACG
 +
CTTTGTGATCTTTATGATACACTGACAATCACCCAAGCTGTCATTTTCTGCAACACAAAG
 +
AGAAAGGTTGATTGGCTTACGGAAAGAATGCGCAGCAATAACTTCACAGTATCAGCTATG
 +
CATGGCGACATGCCTCAAAAGGAAAGGGATGCCATTATGGGTGAATTCAGGTCTGGTGCA
 +
ACCCGTGTTCTAATCACGACAGATGTGTGGGCTCGAGGCCTCGATGTTCAGCAGGTCTCT
 +
CTTGTCATAAATTATGATCTCCCAAATAATCGTGAACTTTACATCCATCGCATTGGTCGC
 +
TCTGGACGTTTTGGTCGCAAGGGTGTGGCCATCAATTTTGTCAAAAAGGAAGACATCCGT
 +
ATCCTGAGAGATATCGAGCAGTACTACAGCACGCAGATTGATGAAATGCCAATGAATGTT
 +
GCTGATCTAATTTGA</dnaseqindica>|
 +
SOURCE = '''''Oryza sativa''''' eIF4A-3|
 
}}
 
}}
  
 
=='''Conserved Domains '''==
 
=='''Conserved Domains '''==
 
{{Str|
 
{{Str|
SOURCE = '''''Panax ginseng''''' EIF|
+
SOURCE = SOURCE = '''''Oryza sativa''''' eIF4A-3||
 
Str= [[File:eif_1.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:EIF]]|
 
Str= [[File:eif_1.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:EIF]]|
 
}}
 
}}
Line 206: Line 215:
 
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=cd00268 NCBI Conserved Protein Domain Family]
 
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=cd00268 NCBI Conserved Protein Domain Family]
 
* [https://en.wikipedia.org/wiki/Eukaryotic_initiation_factor WikiPedia]
 
* [https://en.wikipedia.org/wiki/Eukaryotic_initiation_factor WikiPedia]
* [http://pfam.xfam.org/family/SAND Pfam]
+
* [http://pfam.xfam.org/family/PF01652 Pfam]

Latest revision as of 02:18, 30 August 2017

Synonymous Genes

  • EIF <=> eIF1,IF4α,eIF4A-3,IF3G1

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Ammopiptanthus mongolicus Eukaryotic initiation factor
  • Abiotic Stresses
2012
Cajanus cajan Initiation factor 4a
  • Drought Stress
2015
Carica papaya Eukaryotic initiation factor 4A
  • Different Experimental Conditions
2012
Elaeis guineensis Eukaryotic initiation factor 4A
  • Abiotic Stress
2014
Litsea cubeba Eukaryotic initiation factor 4-alpha
  • Different Developmental Stages & Tissues
2013
Oryza sativa Eukaryotic initiation factor 4A-3
  • Anther Development
2014
Oryza sativa Eukaryotic initiation factor 4A-3
  • Seed Development
2010
Panax ginseng Eukaryotic translation initiation factor 3G1
  • Different Tissues & Abiotic Stress
2015
Panicum virgatum Eukaryotic initiation factor 4a
  • Different Tissues & Abiotic Stress
2014
Pennisetum glaucum Eukaryotic initiation factor 4A
  • Different Tissues & Genotypes
2015
Pyropia yezoensis Translation initiation factor 4A
  • Different Developmental Stages & Abiotic Stress
2014
Sorghum bicolor Eukaryotic Initiation Factor 4A
  • Different Tissues & Abiotic Stress
2016
Brachiaria brizantha Eukaryotic initiation factor 4A
  • Different Sex & Tissues
2013
Craterostigma plantagineum Elongation factor 1-alpha
  • Different Tissues
2015
Litsea cubeba Eukaryotic initiation factor 4-alpha
  • Different Developmental Stages & Tissues
2013
Panicum virgatum Eukaryotic initiation factor 4a
  • Different Tissues & Abiotic Stress
2014
Pennisetum glaucum Eukaryotic initiation factor 4A
  • Different Tissues & Genotypes
2015
Pyropia yezoensis Translation initiation factor 4A
  • Different Developmental Stages & Abiotic Stress
2014
Bombyx mori Translation initiation factor 4A
  • Different Developmental Stages
2008
Bombyx mori Translation initiation factor 3 subunit 4
  • Different Developmental Stages
2008
Bombyx mori Translation initiation factor 3 subunit 5
  • Different Developmental Stages
2008

Featured Sequence

The Sequence of Oryza sativa eIF4A-3 is displayed as example.

000001 ATGGCGGCGG CCACCACGTC GCGGCGCGGC CCGGGCGCCA TGGACGACGA GAACCTCACC TTCGAGACCT 000070
000071 CCCCGGGGGT CGAGGTCATC AGCAGCTTCG ACCAGATGGG GATCCGCGAC GACCTCCTCC GCGGCATCTA 000140
000141 CGCCTACGGC TTCGAGAAGC CCTCCGCCAT CCAGCAGCGC GCCGTCCTCC CCATCATCAG CGGCCGCGAC 000210
000211 GTCATCGCCC AGGCCCAGTC CGGGACCGGC AAGACCTCCA TGATCTCGCT CTCCGTCTGC CAGATCGTAG 000280
000281 ACACCGCCGT CCGTGAGGTG CAGGCTTTAA TACTGTCACC AACTAGAGAA CTTGCTGCAC AAACAGAAAG 000350
000351 AGTTATGCTG GCTATCGGTG ACTTCATCAA TATCCAAGTG CATGCTTGTA TTGGTGGCAA AAGTATTGGT 000420
000421 GAGGATATTA GAAAGCTTGA GCACGGAGTG CATGTGGTGT CAGGAACACC TGGCAGAGTC TGTGATATGA 000490
000491 TCAAGAGAAG GACCTTGCGT ACAAGAGCCA TTAAGCTCCT AATTCTGGAT GAAGCTGATG AGATGTTGGG 000560
000561 CAGAGGCTTT AAGGATCAGA TATATGATGT GTACAGATAC CTCCCTCCAG AACTCCAGGT TTGCTTGATC 000630
000631 TCCGCAACTC TGCCTCACGA GATCTTGGAA ATGACCAGCA AGTTCATGAC TGATCCAGTT CGGATCCTTG 000700
000701 TGAAGCGTGA TGAATTGACT CTAGAGGGCA TCAAACAATT CTTTGTTGCT GTTGAGAAAG AAGAATGGAA 000770
000771 GTTTGACACG CTTTGTGATC TTTATGATAC ACTGACAATC ACCCAAGCTG TCATTTTCTG CAACACAAAG 000840
000841 AGAAAGGTTG ATTGGCTTAC GGAAAGAATG CGCAGCAATA ACTTCACAGT ATCAGCTATG CATGGCGACA 000910
000911 TGCCTCAAAA GGAAAGGGAT GCCATTATGG GTGAATTCAG GTCTGGTGCA ACCCGTGTTC TAATCACGAC 000980
000981 AGATGTGTGG GCTCGAGGCC TCGATGTTCA GCAGGTCTCT CTTGTCATAA ATTATGATCT CCCAAATAAT 001050
001051 CGTGAACTTT ACATCCATCG CATTGGTCGC TCTGGACGTT TTGGTCGCAA GGGTGTGGCC ATCAATTTTG 001120
001121 TCAAAAAGGA AGACATCCGT ATCCTGAGAG ATATCGAGCA GTACTACAGC ACGCAGATTG ATGAAATGCC 001190
001191 AATGAATGTT GCTGATCTAA TTTGA

Conserved Domains

The Conserved domains of SOURCE = Oryza sativa eIF4A-3 is displayed as example.

Eif 1.png

External Links