Difference between revisions of "Gene:HMBS"

From ICG
Jump to navigation Jump to search
(Created page with "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* HMBS <=> HMBS, hmbs
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 58: Line 59:
 
|align="center"|2012
 
|align="center"|2012
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>CCGGAAGTGACGCGAGGCTCTGCGGAGACCAGGAGTCAGACTGTAGGACGACCTCGGGTCCCACGTGTCC
 +
CCGGTACTCGCCGGCCGGAGCCCCCGGCTTCCCGGGGCCGGGGGACCTTAGCGGCACCCACACACAGCCT
 +
ACTTTCCAAGCGGAGCCATGTCTGGTAACGGCAATGCGGCTGCAACGGCGGAAGAAAACAGCCCAAAGAT
 +
GAGAGTGATTCGCGTGGGTACCCGCAAGAGCCAGCTTGCTCGCATACAGACGGACAGTGTGGTGGCAACA
 +
TTGAAAGCCTCGTACCCTGGCCTGCAGTTTGAAATCATTGCTATGTCCACCACAGGGGACAAGATTCTTG
 +
ATACTGCACTCTCTAAGATTGGAGAGAAAAGCCTGTTTACCAAGGAGCTTGAACATGCCCTGGAGAAGAA
 +
TGAAGTGGACCTGGTTGTTCACTCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACCATCGGA
 +
GCCATCTGCAAGCGGGAAAACCCTCATGATGCTGTTGTCTTTCACCCAAAATTTGTTGGGAAGACCCTAG
 +
AAACCCTGCCAGAGAAGAGTGTGGTGGGAACCAGCTCCCTGCGAAGAGCAGCCCAGCTGCAGAGAAAGTT
 +
CCCGCATCTGGAGTTCAGGAGTATTCGGGGAAACCTCAACACCCGGCTTCGGAAGCTGGACGAGCAGCAG
 +
GAGTTCAGTGCCATCATCCTGGCAACAGCTGGCCTGCAGCGCATGGGCTGGCACAACCGGGTGGGGCAGA
 +
TCCTGCACCCTGAGGAATGCATGTATGCTGTGGGCCAGGGGGCCTTGGGCGTGGAAGTGCGAGCCAAGGA
 +
CCAGGACATCTTGGATCTGGTGGGTGTGCTGCACGATCCCGAGACTCTGCTTCGCTGCATCGCTGAAAGG
 +
GCCTTCCTGAGGCACCTGGAAGGAGGCTGCAGTGTGCCAGTAGCCGTGCATACAGCTATGAAGGATGGGC
 +
AACTGTACCTGACTGGAGGAGTCTGGAGTCTAGACGGCTCAGATAGCATACAAGAGACCATGCAGGCTAC
 +
CATCCATGTCCCTGCCCAGCATGAAGATGGCCCTGAGGATGACCCACAGTTGGTAGGCATCACTGCTCGT
 +
AACATTCCACGAGGGCCCCAGTTGGCTGCCCAGAACTTGGGCATCAGCCTGGCCAACTTGTTGCTGAGCA
 +
AAGGAGCCAAAAACATCCTGGATGTTGCACGGCAGCTTAACGATGCCCATTAACTGGTTTGTGGGGCACA
 +
GATGCCTGGGTTGCTGCTGTCCAGTGCCTACATCCCGGGCCTCAGTGCCCCATTCTCACTGCTATCTGGG
 +
GAGTGATTACCCCGGGAGACTGAACTGCAGGGTTCAAGCCTTCCAGGGATTTGCCTCACCTTGGGGCCTT
 +
GATGACTGCCTTGCCTCCTCAGTATGTGGGGGCTTCATCTCTTTAGAGAAGTCCAAGCAACAGCCTTTGA
 +
ATGTAACCAATCCTACTAATAAACCAGTTCTGAAGGTGTAAAAAAAAAAAAAAAAA</dnaseqindica>|
 +
SOURCE = '''''Homo sapiens''''' HMBS|
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Homo sapiens''''' HMBS|
 +
Str= [[File:HMBS.png|center|770px|link=Gene:HMBS]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
+
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=TIGR00212 NCBI Conserved Protein Domain Family]
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
+
* [https://en.wikipedia.org/wiki/Porphobilinogen_deaminase WikiPedia]
* [http://pfam.xfam.org/family/SAND Pfam]
+
* [http://pfam.xfam.org/family/PF01379 Pfam]

Latest revision as of 02:37, 30 August 2017

Synonymous Genes

  • HMBS <=> HMBS, hmbs

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Capra hircus Hydroxymethylbilane synthase
  • Intramuscular Fat Deposition
2015
Gallus gallus Hydroxymethylbilane synthase
  • Embryo Fibroblasts
2016
Homo sapiens Hydroxymethylbilane synthase
  • U87MG Cell Line
2012
Homo sapiens Hydroxymethylbilane synthase
  • Hepatocellular Carcinoma
2008
Leptospira interrogans Hydroxymethylbilane synthase
  • Different Tissues & Abiotic Stress
2008
Rattus norvegicus Hydroxymethylbilane synthase
  • Ischemia & Reperfusion Model
2012

Featured Sequence

The Sequence of Homo sapiens HMBS is displayed as example.

000001 CCGGAAGTGA CGCGAGGCTC TGCGGAGACC AGGAGTCAGA CTGTAGGACG ACCTCGGGTC CCACGTGTCC 000070
000071 CCGGTACTCG CCGGCCGGAG CCCCCGGCTT CCCGGGGCCG GGGGACCTTA GCGGCACCCA CACACAGCCT 000140
000141 ACTTTCCAAG CGGAGCCATG TCTGGTAACG GCAATGCGGC TGCAACGGCG GAAGAAAACA GCCCAAAGAT 000210
000211 GAGAGTGATT CGCGTGGGTA CCCGCAAGAG CCAGCTTGCT CGCATACAGA CGGACAGTGT GGTGGCAACA 000280
000281 TTGAAAGCCT CGTACCCTGG CCTGCAGTTT GAAATCATTG CTATGTCCAC CACAGGGGAC AAGATTCTTG 000350
000351 ATACTGCACT CTCTAAGATT GGAGAGAAAA GCCTGTTTAC CAAGGAGCTT GAACATGCCC TGGAGAAGAA 000420
000421 TGAAGTGGAC CTGGTTGTTC ACTCCTTGAA GGACCTGCCC ACTGTGCTTC CTCCTGGCTT CACCATCGGA 000490
000491 GCCATCTGCA AGCGGGAAAA CCCTCATGAT GCTGTTGTCT TTCACCCAAA ATTTGTTGGG AAGACCCTAG 000560
000561 AAACCCTGCC AGAGAAGAGT GTGGTGGGAA CCAGCTCCCT GCGAAGAGCA GCCCAGCTGC AGAGAAAGTT 000630
000631 CCCGCATCTG GAGTTCAGGA GTATTCGGGG AAACCTCAAC ACCCGGCTTC GGAAGCTGGA CGAGCAGCAG 000700
000701 GAGTTCAGTG CCATCATCCT GGCAACAGCT GGCCTGCAGC GCATGGGCTG GCACAACCGG GTGGGGCAGA 000770
000771 TCCTGCACCC TGAGGAATGC ATGTATGCTG TGGGCCAGGG GGCCTTGGGC GTGGAAGTGC GAGCCAAGGA 000840
000841 CCAGGACATC TTGGATCTGG TGGGTGTGCT GCACGATCCC GAGACTCTGC TTCGCTGCAT CGCTGAAAGG 000910
000911 GCCTTCCTGA GGCACCTGGA AGGAGGCTGC AGTGTGCCAG TAGCCGTGCA TACAGCTATG AAGGATGGGC 000980
000981 AACTGTACCT GACTGGAGGA GTCTGGAGTC TAGACGGCTC AGATAGCATA CAAGAGACCA TGCAGGCTAC 001050
001051 CATCCATGTC CCTGCCCAGC ATGAAGATGG CCCTGAGGAT GACCCACAGT TGGTAGGCAT CACTGCTCGT 001120
001121 AACATTCCAC GAGGGCCCCA GTTGGCTGCC CAGAACTTGG GCATCAGCCT GGCCAACTTG TTGCTGAGCA 001190
001191 AAGGAGCCAA AAACATCCTG GATGTTGCAC GGCAGCTTAA CGATGCCCAT TAACTGGTTT GTGGGGCACA 001260
001261 GATGCCTGGG TTGCTGCTGT CCAGTGCCTA CATCCCGGGC CTCAGTGCCC CATTCTCACT GCTATCTGGG 001330
001331 GAGTGATTAC CCCGGGAGAC TGAACTGCAG GGTTCAAGCC TTCCAGGGAT TTGCCTCACC TTGGGGCCTT 001400
001401 GATGACTGCC TTGCCTCCTC AGTATGTGGG GGCTTCATCT CTTTAGAGAA GTCCAAGCAA CAGCCTTTGA 001470
001471 ATGTAACCAA TCCTACTAAT AAACCAGTTC TGAAGGTGTA AAAAAAAAAA AAAAAA

Conserved Domains

The Conserved domains of Homo sapiens HMBS is displayed as example.

HMBS.png

External Links