Difference between revisions of "Gene:Other rRNA"

From ICG
Jump to navigation Jump to search
 
(4 intermediate revisions by one other user not shown)
Line 1: Line 1:
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* 16S rRNA, 28S rRNA
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 50: Line 51:
 
|align="center"|2014
 
|align="center"|2014
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>ACCCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGG
 +
TCCTGACGTGCAAATCGGTCGTCCGACCCGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTG
 +
GTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCGCTCGGGGCGGCGGTGCAGTTTTACCCGGTAAAGCGA
 +
ATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTCAATGGGTAAGACGCCCGGC
 +
TCGCTGGCGTGGAGCCGGGCCGTGGAATGCGAGCGCTCAGTGGGCCACTTTTGGTAAGCAGAACTGGCGC
 +
TGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGAGCCCAGAAAAGGTGTTG
 +
GTTGATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTG
 +
CCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCAGGCCCATACCCGGCCGTCGCCGGCGGTG
 +
CGGAGCCGCGGGGGCTACGCCGCGACGAGTAGGAGGGCCGCTGCGGTGCGCCTGGAAGCCTGGGGCGCGG
 +
GCCCGGGTGGAGCCGCCGCAGGTGCAGATCTTGGTGGTAGTAGCAACTATTCAAACGAGAGCTTTGAAGG
 +
CCGAAGTGGAGCAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTTGGTCCTAAGCGATAGGCGAG
 +
CGCCGTTCCGAAGGGACGGGCGATAGCCTCCGTTGCCCTCAGCCGATCGAAAGGGAGTCGGGTTCAGATC
 +
CCCGAATCCGGGGCGGCGGAGACGGGCGCCGCGAGGCGCCCAGTGCGGTAACGCAAGCGATCCCGGAGAA
 +
GCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAAGGGCCGGGCGCCCTGGAACGGGTTCGCCC
 +
CGAGAGAGGGGCCCGCGCCTTGGAAAGCGTCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCGT
 +
GAAAATCCGGGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGT</dnaseqindica>|
 +
SOURCE = '''''Gallus gallus''''' 28S rRNA|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
 
 
* [https://en.wikipedia.org/wiki/16S_ribosomal_RNA WikiPedia (16S ribosomal RNA)]
 
* [https://en.wikipedia.org/wiki/16S_ribosomal_RNA WikiPedia (16S ribosomal RNA)]
* [http://pfam.xfam.org/family/SAND Pfam]
+
* [https://en.wikipedia.org/wiki/28S_ribosomal_RNA WikiPedia (28S ribosomal RNA)]

Latest revision as of 02:18, 30 August 2017

Synonymous Genes

  • 16S rRNA, 28S rRNA

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Gallus gallus 28S rRNA gene
  • Lymphoid Organs
2016
Helicoverpa armigera 28S ribosomal RNA
  • Different Biotic and Abiotic conditions
2015
Lucilia cuprina 28S rRNA
  • Different Developmental Stages
2010
Daucus carota 5.8S, 18S and 25S ribosomal RNA genes and ITS regions
  • Different Tissues
2015
Acyrthosiphon pisum 16S ribosomal RNA
  • Different Developmental Stages & Temperature
2014

Featured Sequence

The Sequence of Gallus gallus 28S rRNA is displayed as example.

000001 ACCCGAAAGA TGGTGAACTA TGCCTGGGCA GGGCGAAGCC AGAGGAAACT CTGGTGGAGG TCCGTAGCGG 000070
000071 TCCTGACGTG CAAATCGGTC GTCCGACCCG GGTATAGGGG CGAAAGACTA ATCGAACCAT CTAGTAGCTG 000140
000141 GTTCCCTCCG AAGTTTCCCT CAGGATAGCT GGCGCTCGGG GCGGCGGTGC AGTTTTACCC GGTAAAGCGA 000210
000211 ATGATTAGAG GTCTTGGGGC CGAAACGATC TCAACCTATT CTCAAACTTT CAATGGGTAA GACGCCCGGC 000280
000281 TCGCTGGCGT GGAGCCGGGC CGTGGAATGC GAGCGCTCAG TGGGCCACTT TTGGTAAGCA GAACTGGCGC 000350
000351 TGCGGGATGA ACCGAACGCC GGGTTAAGGC GCCCGATGCC GACGCTCATC AGAGCCCAGA AAAGGTGTTG 000420
000421 GTTGATCTAG ACAGCAGGAC GGTGGCCATG GAAGTCGGAA CCCGCTAAGG AGTGTGTAAC AACTCACCTG 000490
000491 CCGAATCAAC TAGCCCTGAA AATGGATGGC GCTGGAGCGT CAGGCCCATA CCCGGCCGTC GCCGGCGGTG 000560
000561 CGGAGCCGCG GGGGCTACGC CGCGACGAGT AGGAGGGCCG CTGCGGTGCG CCTGGAAGCC TGGGGCGCGG 000630
000631 GCCCGGGTGG AGCCGCCGCA GGTGCAGATC TTGGTGGTAG TAGCAACTAT TCAAACGAGA GCTTTGAAGG 000700
000701 CCGAAGTGGA GCAGGGTTCC ATGTGAACAG CAGTTGAACA TGGGTCAGTT GGTCCTAAGC GATAGGCGAG 000770
000771 CGCCGTTCCG AAGGGACGGG CGATAGCCTC CGTTGCCCTC AGCCGATCGA AAGGGAGTCG GGTTCAGATC 000840
000841 CCCGAATCCG GGGCGGCGGA GACGGGCGCC GCGAGGCGCC CAGTGCGGTA ACGCAAGCGA TCCCGGAGAA 000910
000911 GCCGGCGGGA GCCCCGGGGA GAGTTCTCTT TTCTTTGTGA AGGGCCGGGC GCCCTGGAAC GGGTTCGCCC 000980
000981 CGAGAGAGGG GCCCGCGCCT TGGAAAGCGT CGCGGTTCCG GCGGCGTCCG GTGAGCTCTC GCTGGCCCGT 001050
001051 GAAAATCCGG GGGAGAGGGT GTAAATCTCG CGCCGGGCCG TACCCATATC CGCAGCAGGT CTCCAAGGT

External Links