Difference between revisions of "Gene:PGK"

From ICG
Jump to navigation Jump to search
 
(7 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* PGK <=> PGK,  PGK1
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 86: Line 87:
 
=='''Featured Sequence'''==
 
=='''Featured Sequence'''==
 
{{DNA|
 
{{DNA|
DNA = <dnaseqindica></dnaseqindica>|
+
DNA = <dnaseqindica>GAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGC
SOURCE = '''''Homo sapiens''''' EF1α|
+
CCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAAT
 +
CACCGACCTCTCTCCCCAGCTGTATTTCCAAAATGTCGCTTTCTAACAAGCTGACGCTGGACAAGCTGGA
 +
CGTTAAAGGGAAGCGGGTCGTTATGAGAGTCGACTTCAATGTTCCTATGAAGAACAACCAGATAACAAAC
 +
AACCAGAGGATTAAGGCTGCTGTCCCAAGCATCAAATTCTGCTTGGACAATGGAGCCAAGTCGGTAGTCC
 +
TTATGAGCCACCTAGGCCGGCCTGATGGTGTGCCCATGCCTGACAAGTACTCCTTAGAGCCAGTTGCTGT
 +
AGAACTCAAATCTCTGCTGGGCAAGGATGTTCTGTTCTTGAAGGACTGTGTAGGCCCAGAAGTGGAGAAA
 +
GCCTGTGCCAACCCAGCTGCTGGGTCTGTCATCCTGCTGGAGAACCTCCGCTTTCATGTGGAGGAAGAAG
 +
GGAAGGGAAAAGATGCTTCTGGGAACAAGGTTAAAGCCGAGCCAGCCAAAATAGAAGCTTTCCGAGCTTC
 +
ACTTTCCAAGCTAGGGGATGTCTATGTCAATGATGCTTTTGGCACTGCTCACAGAGCCCACAGCTCCATG
 +
GTAGGAGTCAATCTGCCACAGAAGGCTGGTGGGTTTTTGATGAAGAAGGAGCTGAACTACTTTGCAAAGG
 +
CCTTGGAGAGCCCAGAGCGACCCTTCCTGGCCATCCTGGGCGGAGCTAAAGTTGCAGACAAGATCCAGCT
 +
CATCAATAATATGCTGGACAAAGTCAATGAGATGATTATTGGTGGTGGAATGGCTTTTACCTTCCTTAAG
 +
GTGCTCAACAACATGGAGATTGGCACTTCTCTGTTTGATGAAGAGGGAGCCAAGATTGTCAAAGACCTAA
 +
TGTCCAAAGCTGAGAAGAATGGTGTGAAGATTACCTTGCCTGTTGACTTTGTCACTGCTGACAAGTTTGA
 +
TGAGAATGCCAAGACTGGCCAAGCCACTGTGGCTTCTGGCATACCTGCTGGCTGGATGGGCTTGGACTGT
 +
GGTCCTGAAAGCAGCAAGAAGTATGCTGAGGCTGTCACTCGGGCTAAGCAGATTGTGTGGAATGGTCCTG
 +
TGGGGGTATTTGAATGGGAAGCTTTTGCCCGGGGAACCAAAGCTCTCATGGATGAGGTGGTGAAAGCCAC
 +
TTCTAGGGGCTGCATCACCATCATAGGTGGTGGAGACACTGCCACTTGCTGTGCCAAATGGAACACGGAG
 +
GATAAAGTCAGCCATGTGAGCACTGGGGGTGGTGCCAGTTTGGAGCTCCTGGAAGGTAAAGTCCTTCCTG
 +
GGGTGGATGCTCTCAGCAATATTTAGTACTTTCCTGCCTTTTAGTTCCTGTGCACAGCCCCTAAGTCAAC
 +
TTAGCATTTTCTGCATCTCCACTTGGCATTAGCTAAAACCTTCCATGTCAAGATTCAGCTAGTGGCCAAG
 +
AGATGCAGTGCCAGGAACCCTTAAACAGTTGCACAGCATCTCAGCTCATCTTCACTGCACCCTGGATTTG
 +
CATACATTCTTCAAGATCCCATTTGAATTTTTTAGTGACTAAACCATTGTGCATTCTAGAGTGCATATAT
 +
TTATATTTTGCCTGTTAAAAAGAAAGTGAGCAGTGTTAGCTTAGTTCTCTTTTGATGTAGGTTATTATGA
 +
TTAGCTTTGTCACTGTTTCACTACTCAGCATGGAAACAAGATGAAATTCCATTTGTAGGTAGTGAGACAA
 +
AATTGATGATCCATTAAGTAAACAATAAAAGTGTCCATTGAAACCGTGATTTTTTTTTTTTTCCTGTCAT
 +
ACTTTGTTAGGAAGGGTGAGAATAGAATCTTGAGGAACGGATCAGATGTCTATATTGCTGAATGCAAGAA
 +
GTGGGGCAGCAGCAGTGGAGAGATGGGACAATTAGATAAATGTCCATTCTTTATCAAGGGCCTACTTTAT
 +
GGCAGACATTGTGCTAGTGCTTTTATTCTAACTTTTATTTTTATCAGTTACACATGATCATAATTTAAAA
 +
AGTCAAGGCTTATAACAAAAAAGCCCCAGCCCATTCCTCCCATTCAAGATTCCCACTCCCCAGAGGTGAC
 +
CACTTTCAACTCTTGAGTTTTTCAGGTATATACCTCCATGTTTCTAAGTAATATGCTTATATTGTTCACT
 +
TCTTTTTTTTTTATTTTTTAAAGAAATCTATTTCATACCATGGAGGAAGGCTCTGTTCCACATATATTTC
 +
CACTTCTTCATTCTCTCGGTATAGTTTTGTCACAATTATAGATTAGATCAAAAGTCTACATAACTAATAC
 +
AGCTGAGCTATGTAGTATGCTATGATTAAATTTACTTATGTAAAAAAAAAAAAAAAAAA</dnaseqindica>|
 +
SOURCE = '''''Homo sapiens''''' PGK|
 
}}
 
}}
  
 
=='''Conserved Domains '''==
 
=='''Conserved Domains '''==
 
{{Str|
 
{{Str|
SOURCE = |
+
SOURCE = '''''Homo sapiens''''' PGK|
Str= [[File:|center|770px|]]|
+
Str= [[File:PGK.png|center|770px|]]|
 
}}
 
}}
  
'''Bold text'''=='''''External Links'''''==
+
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
+
* [https://en.wikipedia.org/wiki/Phosphoglycerate_kinase WikiPedia]
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
+
* [http://pfam.xfam.org/family/PF00162 Pfam]
* [http://pfam.xfam.org/family/SAND Pfam]
 

Latest revision as of 02:32, 30 August 2017

Synonymous Genes

  • PGK <=> PGK, PGK1

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Atropa belladonna Phosphoglycerate kinase
  • Different Tissues & Abiotic Stress
2014
Chrysanthemum lavandulifolium Phosphoglycerate kinase
  • Flower Development
2016
Delomys sublineatus Phosphoglycerate kinase 1
  • Liver Samples
2010
Homo sapiens Phosphoglycerate kinase-1
  • Lung Cancer
2015
Homo sapiens Phosphoglycerate kinase 1
  • Colonic and Vaginal Epithelial Cell Lines
2014
Iris hybrid cultivar Cytosolic phosphoglycerate kinase
  • Abiotic Stress
2014
Mus musculus Phosphoglycerate kinase 1
  • Embryonic Stem Cells
2011
Rattus norvegicus Phosphoglycerate kinase 1
  • Asphyxial Cardiac Arrest Model
2008
Sus scrofa Phosphoglycerate kinase 1
  • Oocytes & Preimplantation Embryos
2007

Featured Sequence

The Sequence of Homo sapiens PGK is displayed as example.

000001 GAGAGCAGCG GCCGGGAAGG GGCGGTGCGG GAGGCGGGGT GTGGGGCGGT AGTGTGGGCC CTGTTCCTGC 000070
000071 CCGCGCGGTG TTCCGCATTC TGCAAGCCTC CGGAGCGCAC GTCGGCAGTC GGCTCCCTCG TTGACCGAAT 000140
000141 CACCGACCTC TCTCCCCAGC TGTATTTCCA AAATGTCGCT TTCTAACAAG CTGACGCTGG ACAAGCTGGA 000210
000211 CGTTAAAGGG AAGCGGGTCG TTATGAGAGT CGACTTCAAT GTTCCTATGA AGAACAACCA GATAACAAAC 000280
000281 AACCAGAGGA TTAAGGCTGC TGTCCCAAGC ATCAAATTCT GCTTGGACAA TGGAGCCAAG TCGGTAGTCC 000350
000351 TTATGAGCCA CCTAGGCCGG CCTGATGGTG TGCCCATGCC TGACAAGTAC TCCTTAGAGC CAGTTGCTGT 000420
000421 AGAACTCAAA TCTCTGCTGG GCAAGGATGT TCTGTTCTTG AAGGACTGTG TAGGCCCAGA AGTGGAGAAA 000490
000491 GCCTGTGCCA ACCCAGCTGC TGGGTCTGTC ATCCTGCTGG AGAACCTCCG CTTTCATGTG GAGGAAGAAG 000560
000561 GGAAGGGAAA AGATGCTTCT GGGAACAAGG TTAAAGCCGA GCCAGCCAAA ATAGAAGCTT TCCGAGCTTC 000630
000631 ACTTTCCAAG CTAGGGGATG TCTATGTCAA TGATGCTTTT GGCACTGCTC ACAGAGCCCA CAGCTCCATG 000700
000701 GTAGGAGTCA ATCTGCCACA GAAGGCTGGT GGGTTTTTGA TGAAGAAGGA GCTGAACTAC TTTGCAAAGG 000770
000771 CCTTGGAGAG CCCAGAGCGA CCCTTCCTGG CCATCCTGGG CGGAGCTAAA GTTGCAGACA AGATCCAGCT 000840
000841 CATCAATAAT ATGCTGGACA AAGTCAATGA GATGATTATT GGTGGTGGAA TGGCTTTTAC CTTCCTTAAG 000910
000911 GTGCTCAACA ACATGGAGAT TGGCACTTCT CTGTTTGATG AAGAGGGAGC CAAGATTGTC AAAGACCTAA 000980
000981 TGTCCAAAGC TGAGAAGAAT GGTGTGAAGA TTACCTTGCC TGTTGACTTT GTCACTGCTG ACAAGTTTGA 001050
001051 TGAGAATGCC AAGACTGGCC AAGCCACTGT GGCTTCTGGC ATACCTGCTG GCTGGATGGG CTTGGACTGT 001120
001121 GGTCCTGAAA GCAGCAAGAA GTATGCTGAG GCTGTCACTC GGGCTAAGCA GATTGTGTGG AATGGTCCTG 001190
001191 TGGGGGTATT TGAATGGGAA GCTTTTGCCC GGGGAACCAA AGCTCTCATG GATGAGGTGG TGAAAGCCAC 001260
001261 TTCTAGGGGC TGCATCACCA TCATAGGTGG TGGAGACACT GCCACTTGCT GTGCCAAATG GAACACGGAG 001330
001331 GATAAAGTCA GCCATGTGAG CACTGGGGGT GGTGCCAGTT TGGAGCTCCT GGAAGGTAAA GTCCTTCCTG 001400
001401 GGGTGGATGC TCTCAGCAAT ATTTAGTACT TTCCTGCCTT TTAGTTCCTG TGCACAGCCC CTAAGTCAAC 001470
001471 TTAGCATTTT CTGCATCTCC ACTTGGCATT AGCTAAAACC TTCCATGTCA AGATTCAGCT AGTGGCCAAG 001540
001541 AGATGCAGTG CCAGGAACCC TTAAACAGTT GCACAGCATC TCAGCTCATC TTCACTGCAC CCTGGATTTG 001610
001611 CATACATTCT TCAAGATCCC ATTTGAATTT TTTAGTGACT AAACCATTGT GCATTCTAGA GTGCATATAT 001680
001681 TTATATTTTG CCTGTTAAAA AGAAAGTGAG CAGTGTTAGC TTAGTTCTCT TTTGATGTAG GTTATTATGA 001750
001751 TTAGCTTTGT CACTGTTTCA CTACTCAGCA TGGAAACAAG ATGAAATTCC ATTTGTAGGT AGTGAGACAA 001820
001821 AATTGATGAT CCATTAAGTA AACAATAAAA GTGTCCATTG AAACCGTGAT TTTTTTTTTT TTCCTGTCAT 001890
001891 ACTTTGTTAG GAAGGGTGAG AATAGAATCT TGAGGAACGG ATCAGATGTC TATATTGCTG AATGCAAGAA 001960
001961 GTGGGGCAGC AGCAGTGGAG AGATGGGACA ATTAGATAAA TGTCCATTCT TTATCAAGGG CCTACTTTAT 002030
002031 GGCAGACATT GTGCTAGTGC TTTTATTCTA ACTTTTATTT TTATCAGTTA CACATGATCA TAATTTAAAA 002100
002101 AGTCAAGGCT TATAACAAAA AAGCCCCAGC CCATTCCTCC CATTCAAGAT TCCCACTCCC CAGAGGTGAC 002170
002171 CACTTTCAAC TCTTGAGTTT TTCAGGTATA TACCTCCATG TTTCTAAGTA ATATGCTTAT ATTGTTCACT 002240
002241 TCTTTTTTTT TTATTTTTTA AAGAAATCTA TTTCATACCA TGGAGGAAGG CTCTGTTCCA CATATATTTC 002310
002311 CACTTCTTCA TTCTCTCGGT ATAGTTTTGT CACAATTATA GATTAGATCA AAAGTCTACA TAACTAATAC 002380
002381 AGCTGAGCTA TGTAGTATGC TATGATTAAA TTTACTTATG TAAAAAAAAA AAAAAAAAA

Conserved Domains

The Conserved domains of Homo sapiens PGK is displayed as example.

PGK.png

External Links