Difference between revisions of "Gene:RPS"

From ICG
Jump to navigation Jump to search
(Created page with " =='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
 
(10 intermediate revisions by 2 users not shown)
Line 1: Line 1:
  
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* RPS <=> rps17, RPS18, RPS9, RPS23, RPS19, RPS5
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 28: Line 29:
 
|-
 
|-
 
|align="center"|[[Bubalus bubalis]]
 
|align="center"|[[Bubalus bubalis]]
|align="center"|ribosomal protein S9, ribosomal protein S23
+
|align="center"|ribosomal protein S9
 
||
 
||
 
*''Mammary Epithelial Cells''
 
*''Mammary Epithelial Cells''
Line 34: Line 35:
 
*[http://www.sciencedirect.com/science/article/pii/S1871141312001357?via%3Dihub Identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of buffalo (Bubalus bubalis) during lactation cycle]
 
*[http://www.sciencedirect.com/science/article/pii/S1871141312001357?via%3Dihub Identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of buffalo (Bubalus bubalis) during lactation cycle]
 
|align="center"|2012
 
|align="center"|2012
 +
|-
 +
|align="center"|[[Bubalus bubalis]]
 +
|align="center"|ribosomal protein S23
 +
||
 +
*''Mammary Epithelial Cells''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S1871141312001357?via%3Dihub Identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of buffalo (Bubalus bubalis) during lactation cycle]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Canis lupus familiaris]]
 +
|align="center"|Ribosomal protein S5
 +
||
 +
*''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22531949 Selection of internal reference genes for normalization of quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis in the canine brain and other organs]
 +
|align="center"|2013
 
|-
 
|-
 
|align="center"|[[Canis lupus familiaris]]
 
|align="center"|[[Canis lupus familiaris]]
|align="center"|Ribosomal protein S5, Ribosomal protein S19,  
+
|align="center"|Ribosomal protein S19,  
 
||
 
||
 
*''Different Developmental Stages & Tissues''
 
*''Different Developmental Stages & Tissues''
Line 51: Line 68:
 
|align="center"|2015
 
|align="center"|2015
 
|-
 
|-
|align="center"|[[Coffea arabica L]]
+
|align="center"|[[Coffea arabica L.]]
 
|align="center"|40S ribosomal protein S15
 
|align="center"|40S ribosomal protein S15
 
||
 
||
Line 84: Line 101:
 
|-
 
|-
 
|align="center"|[[Drosophila melanogaster]]
 
|align="center"|[[Drosophila melanogaster]]
|align="center"|Ribosomal protein L32, Ribosomal Protein S20,  
+
|align="center"|Ribosomal protein L32
 +
||
 +
*''Physiological Responses''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/21435341 Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster]
 +
|align="center"|2011
 +
|-
 +
|align="center"|[[Drosophila melanogaster]]
 +
|align="center"|Ribosomal Protein S20,  
 
||
 
||
 
*''Physiological Responses''
 
*''Physiological Responses''
Line 156: Line 181:
 
|-
 
|-
 
|align="center"|[[Nilaparvata lugens]]
 
|align="center"|[[Nilaparvata lugens]]
|align="center"|Ribosomal protein S15, Ribosomal protein S11
+
|align="center"|Ribosomal protein S15
 +
||
 +
*''Different Experimental Conditions''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24466124 Selection and Evaluation of Potential Reference Genes for Gene Expression Analysis in the Brown Planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) Using Reverse-Transcription Quantitative PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Nilaparvata lugens]]
 +
|align="center"|Ribosomal protein S11
 
||
 
||
 
*''Different Experimental Conditions''
 
*''Different Experimental Conditions''
Line 172: Line 205:
 
|-
 
|-
 
|align="center"|[[Plutella xylostella]]
 
|align="center"|[[Plutella xylostella]]
|align="center"|Ribosomal protein S13, Ribosomal protein S23  
+
|align="center"|Ribosomal protein S13
 +
||
 +
*''Different Developmental Stages & Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23983612 Exploring valid reference genes for quantitative real-time PCR analysis in Plutella xylostella (Lepidoptera: Plutellidae)]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Plutella xylostella]]
 +
|align="center"|Ribosomal protein S23  
 
||
 
||
 
*''Different Developmental Stages & Tissues & Abiotic Stress''
 
*''Different Developmental Stages & Tissues & Abiotic Stress''
Line 196: Line 237:
 
|-
 
|-
 
|align="center"|[[Sesamia inferens]]
 
|align="center"|[[Sesamia inferens]]
|align="center"|Ribosomal protein S13, Ribosomal protein S20
+
|align="center"|Ribosomal protein S13
 +
||
 +
*''Different Tissues & Developmental Stages''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25585250 Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae)]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Sesamia inferens]]
 +
|align="center"|Ribosomal protein S20
 
||
 
||
 
*''Different Tissues & Developmental Stages''
 
*''Different Tissues & Developmental Stages''
Line 228: Line 277:
 
|-
 
|-
 
|align="center"|[[Tribolium castaneum]]
 
|align="center"|[[Tribolium castaneum]]
|align="center"|Ribosomal protein S18, Ribosomal protein S3  
+
|align="center"|Ribosomal protein S18
 +
||
 +
*''Fungal Challenge''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/20026205 Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Tribolium castaneum]]
 +
|align="center"|Ribosomal protein S3  
 
||
 
||
 
*''Fungal Challenge''
 
*''Fungal Challenge''
Line 234: Line 291:
 
*[https://www.ncbi.nlm.nih.gov/pubmed/20026205 Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge]
 
*[https://www.ncbi.nlm.nih.gov/pubmed/20026205 Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge]
 
|align="center"|2010
 
|align="center"|2010
 +
|-
 +
|align="center"|[[Pecten maximus]]
 +
|align="center"|40S ribosomal protein SA
 +
||
 +
*''Different Tissues''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S0044848612006217 Selection of reference genes for quantitative RT-PCR studies on the gonad of the bivalve mollusc Pecten maximus L]
 +
|align="center"|2012
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>GGGGTCCTTGGCTGGGCGGGGCTTGCTCGCGGTGGCTTGTGGCTCCTTCCTGCGGTGCTTCTCTCTTTCG
 +
CTCAGGCCCGTGGCGCCGACAGGATGGGCAAGTGTCGTGGACTTCGTACTGCTAGGAAGCTCCGTAGTCA
 +
CCGACGAGACCAGAAGTGGCATGATAAACAGTATAAGAAAGCTCATTTGGGCACAGCCCTAAAGGCCAAC
 +
CCTTTTGGAGGTGCTTCTCATGCAAAAGGAATCGTGCTGGAAAAAGTAGGAGTTGAAGCCAAACAGCCAA
 +
ATTCTGCCATTAGGAAGTGTGTAAGGGTCCAGCTGATCAAGAATGGCAAGAAAATCACAGCCTTTGTACC
 +
CAATGACGGTTGCTTGAACTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGT
 +
CATGCTGTTGGTGATATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTTTCTCTTTTGGCCC
 +
TATACAAAGGCAAGAAGGAAAGACCAAGATCATAAATATTAATGGTGAAAACACTGTAGTAATAAATTTT
 +
CATATGCCAAAAAATGTTTGTATCTTACTGTCCCCTGTTCTCACCACGAAGATCATGTTCATTACCACCA
 +
CCACCCCCCCTTATTTTTTTTATCCTAAACCAGCAAACGCAGGACCTGTACCAATTTTAGGAGACAATAA
 +
GACAGGGTTGTTTCAGGATTCTCTAGAGTTAATAACATTTGTAACCTGGCACAGTTTCCCTCATCCTGTG
 +
GAATAAGAAAATGGGATAGATCTGGAATAAATGTGCAGTATTGTAGTATTACTTTAAGAACTTTAAGGGA
 +
ACTTCAAAAACTCACTGAAATTCTAGTGAGATACTTTCTTTTTTATTCTTGGTATTTTCCATATCGGGTG
 +
CAACACTTCAGTTACCAAATTTCATTGCACATAGATTATCTTAGGTACCCTTGGAAATGCACATTCTTGT
 +
ATCCATCTTACAGGGGCCCAAGATGATAAATAGTAAACTCAAAATTGCTCCCCACTCTGTTTATTATTTA
 +
AAGGTGTCAGGATCTGTGTTGTAATGTGTCTACATTAATGTGTTTAGGAGAATACAGGCATTGGATCATT
 +
TAGTTGATGGAAGTATATGCCAGGCAAGGGAGATAAGGTATACGACAAGACTGATGTTTTCAGTATCTTC
 +
TCATGAGGTTGTCAGAGACCTTCATGTCTTCAAAGACTAGTCAGCAAATGAAGTGGTTTAGTGTAGAGAC
 +
AAGATTGGTTGTGTTTTGATAATTTAAGCTAGGTATTGAGTACATGTGGATTTTGCTGTCCACAAATACT
 +
TGTTTCAGAGTTTTCATGGATACAGTGGCATGGTTGAAATGAAGCTGTGAGCCTTCTGCTTTAAATCTGA
 +
TGTAAGAAACTCCTGTTAACAAATAGTAAGTATGGGTTAATTAGCCCTTTGATCAAAGCCTAGCTTTACA
 +
TTGTTTAGGATCTTTGGAAAACAATTGGTTTGGTTGCCCACTTTCCGTAGGATCAAGAGCAGAACCTTTC
 +
ACATGGCACAGAAGAACCCAGGTTGCGCTTCATACCTGCATATTCCAGCCTTAGCCTGCCATTTCTCTCC
 +
TTGGCACTTTGTGCTCCAGCAACACTGGTCTCAGTTGGTCATCCTCAAACTTGGGTTCCATATCCAGCCT
 +
CAGGACCTCTGTTCCTGTTACTATGGTTCCTTGCATGTCGCCTGCTCTTACTAAAGAGCTCGTGTGTTTT
 +
CCAGCACACTTCGGTTTATCTCTTGATGATGATGCTAGTCTCTCCCTCCGCAAGGGCGGAAAGGCTGCCT
 +
GTTGGTTTGTACCAGTGTTTCCTAACGTGTAGCTGCAGTCAGTATTTGGCTAAGCTGTTCCCAGGGGCTC
 +
AACAGATGCTTTCGGATGAGCCTTAACTGACCCAATCCTTTGTGATGCGGGAGAGATTGCTAGGCCTCGC
 +
TCACCTGGCCAGAACCAGGGAAAGAGGCCGCGGTTGCAGCGCGATTCCAGGCCCTGGGCGTCAGGCGCGG
 +
GGTGGGCAGCTCTCCCCGGGCGGTGGGGCCCTTGTGACCGCGAGGCGGGGCGCACCAGGAAGGGAGTGGG
 +
ACAGCGCGGGCGCCCAGGGATGTGGCCTGGTTACCTGCCTTCTCTGATACGTCAAGACACCTTCAACAAT
 +
GGCTTGCAGCTGTACCCTGTTGGCTGCACCCAGGACGCCCTTTTCACTGCTAAGCAGTCCTACCTGAGGC
 +
CCAGGGGCTGCCAGATTGACCCATAAATAATCTCCGGCGCCTCAGATCCAGAAGCTGCTGAGCCTGATCT
 +
TAGTGCCTTCTCCTTTCTCTGTGTGGCCCCCCAGCCCCTTTCCCCACTGCCTTGTGTCCAAGGCCCTTTC
 +
CTTCATGTATCCATGGAGGAGAGACAAAAATACACATCAATAAAATAAGATAGGGAATCCATAAATAGAC
 +
ATTCAGAAGTATGGCCAACGGATTTATCTTAAAACCAATGGAGGAAGAAGAGTTTCAATAAATGTTGTGG
 +
ACTTCCATTTGTCAAAGACCAAAACAAAGGAACCCCAACCTTACATGTAATACAAACTTAACTCAAAATG
 +
GATCATATATCTAAATGTAAAATGGAAAGCTATAAAACTGAAAACAGACTATCTTTACAACCTAGGCGTA
 +
GGTATAGTTTTTAGACATTACACCAAAAGCACATGCCGTAAAAGAAAAAATAGATAAATTGGTGGATTTC
 +
ATTAAAATTAAAAAACTTTTTCTCTCTGAAAAATCCTGTTAAGCTGGGCGCTGTGGTTCATGCCTGTAAT
 +
CCCAGCACTTTGGGAGGCTGAGTTGGGAAGAAATTAATAGCTTGAGGCCAGGAGTTCAAGATCATCCTGG
 +
GCAGCAAAGTCATACACTCTTGAGGGAAGAGAGAGACCTTCTCATATTGTTTTATATTGTTTTATACTCA
 +
GTACCTGTTTTAAGAAAAAAACAAGGAAGTGAAATCAAAGACAGGCAGCCCGGCACCAGGCCTGAAACCA
 +
GCCCTGGGCCTGCCTGGCCTAAACCTAGTAGTTAAAAATCAACTTACGACTTAGAACCTGATGTTATCCG
 +
TAGATTCCAAGCATTGTATAAAAAAATTGTGAAACTCCCTGTTGTGTTCTGTACCAGTGCATGAAACCCC
 +
TGTCACATATCCCCTAGATTGCTCAATCAATCACGACCCTTTCATGTGAAATCTTTAGTGTTGTGAGCCC
 +
TTAAAAGGGACAGAAATTGTGCACTTGAGGAGCTCAGATTTTAAGGCTGTAGCTTGCCGATGCTCCCAGC
 +
TGAATAAAGCCCTTCCTTCTACAAAAAAAAAAAAA</dnaseqindica>|
 +
SOURCE = '''''Homo sapiens''''' RPS|
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Homo sapiens''''' RPS|
 +
Str= [[File:RPS.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:RPS]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
+
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=cd03367 NCBI Conserved Protein Domain Family]
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
+
* [https://en.wikipedia.org/wiki/Ribosomal_protein WikiPedia]
* [http://pfam.xfam.org/family/SAND Pfam]
+
* [http://pfam.xfam.org/family/PF00164 Pfam]

Latest revision as of 02:53, 30 August 2017

Synonymous Genes

  • RPS <=> rps17, RPS18, RPS9, RPS23, RPS19, RPS5

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Anastrepha obliqua Ribosomal protein S17
  • Different Developmental Stages
2016
Apis mellifera RPS18
  • Bacterial Challenge
2008
Bubalus bubalis ribosomal protein S9
  • Mammary Epithelial Cells
2012
Bubalus bubalis ribosomal protein S23
  • Mammary Epithelial Cells
2012
Canis lupus familiaris Ribosomal protein S5
  • Different Developmental Stages & Tissues
2013
Canis lupus familiaris Ribosomal protein S19,
  • Different Developmental Stages & Tissues
2013
Casuarina glauca 40S ribosomal protein
  • Different Tissues & Abiotic Stress
2015
Coffea arabica L. 40S ribosomal protein S15
  • Different Air CO2 Supply & Temperature
2017
Crassostrea gigas Ribosomal protein S18
  • Different Developmental Stages
2013
Cymbidium kanran RPS3
  • Abiotic Stress
2014
Diabrotica virgifera virgifera ribosomal protein S9
  • Different Developmental Stages & Tissues
2014
Drosophila melanogaster Ribosomal protein L32
  • Physiological Responses
2011
Drosophila melanogaster Ribosomal Protein S20,
  • Physiological Responses
2011
Felis catus Clone E472 ribosomal protein S7
  • Snap-Frozen Tissues
2007
Helicoverpa armigera Ribosomal protein S15
  • Different Biotic and Abiotic conditions
2015
Homo sapiens 40S ribosomal protein S23
  • Breast Cancer
2013
Homo sapiens Ribosomal protein S13
  • Clear Cell Renal Cell Carcinoma
2014
Ixodes scapularis Ribosomal protein S4
  • Different Feeding Phases
2013
Lucilia sericata 40S ribosomal protein S3
  • Immune Challenge
2015
Macrobrachium olfersii Ribosomal protein S6 (RpS6)
  • Different Developmental Stages
2016
Musa acuminata Ribosomal protein S 2
  • Different Experimental Conditions
2011
Nilaparvata lugens Ribosomal protein S15
  • Different Experimental Conditions
2014
Nilaparvata lugens Ribosomal protein S11
  • Different Experimental Conditions
2014
Phytophthora parasitica 40S ribosomal protein S3A
  • Different Developmental Stages
2006
Plutella xylostella Ribosomal protein S13
  • Different Developmental Stages & Tissues & Abiotic Stress
2013
Plutella xylostella Ribosomal protein S23
  • Different Developmental Stages & Tissues & Abiotic Stress
2013
Ruditapes philippinarum 40s Ribosomal Protein s20
  • Copper Treated
2017
Scophthalmus maximus RNA polynerase II subunit D
  • Viral Infection
2013
Sesamia inferens Ribosomal protein S13
  • Different Tissues & Developmental Stages
2015
Sesamia inferens Ribosomal protein S20
  • Different Tissues & Developmental Stages
2015
Spodoptera litura Ribosomal protein S3
  • Abiotic & Biotic treatments
2013
Stenella coeruleoalba Ribosomal Protein S18
  • Striped Dolphin Skin
2006
Symbiodinium Ribosomal protein S4
  • Abiotic Stress
2011
Tribolium castaneum Ribosomal protein S18
  • Fungal Challenge
2010
Tribolium castaneum Ribosomal protein S3
  • Fungal Challenge
2010
Pecten maximus 40S ribosomal protein SA
  • Different Tissues
2012

Featured Sequence

The Sequence of Homo sapiens RPS is displayed as example.

000001 GGGGTCCTTG GCTGGGCGGG GCTTGCTCGC GGTGGCTTGT GGCTCCTTCC TGCGGTGCTT CTCTCTTTCG 000070
000071 CTCAGGCCCG TGGCGCCGAC AGGATGGGCA AGTGTCGTGG ACTTCGTACT GCTAGGAAGC TCCGTAGTCA 000140
000141 CCGACGAGAC CAGAAGTGGC ATGATAAACA GTATAAGAAA GCTCATTTGG GCACAGCCCT AAAGGCCAAC 000210
000211 CCTTTTGGAG GTGCTTCTCA TGCAAAAGGA ATCGTGCTGG AAAAAGTAGG AGTTGAAGCC AAACAGCCAA 000280
000281 ATTCTGCCAT TAGGAAGTGT GTAAGGGTCC AGCTGATCAA GAATGGCAAG AAAATCACAG CCTTTGTACC 000350
000351 CAATGACGGT TGCTTGAACT TTATTGAGGA AAATGATGAA GTTCTGGTTG CTGGATTTGG TCGCAAAGGT 000420
000421 CATGCTGTTG GTGATATTCC TGGAGTCCGC TTTAAGGTTG TCAAAGTAGC CAATGTTTCT CTTTTGGCCC 000490
000491 TATACAAAGG CAAGAAGGAA AGACCAAGAT CATAAATATT AATGGTGAAA ACACTGTAGT AATAAATTTT 000560
000561 CATATGCCAA AAAATGTTTG TATCTTACTG TCCCCTGTTC TCACCACGAA GATCATGTTC ATTACCACCA 000630
000631 CCACCCCCCC TTATTTTTTT TATCCTAAAC CAGCAAACGC AGGACCTGTA CCAATTTTAG GAGACAATAA 000700
000701 GACAGGGTTG TTTCAGGATT CTCTAGAGTT AATAACATTT GTAACCTGGC ACAGTTTCCC TCATCCTGTG 000770
000771 GAATAAGAAA ATGGGATAGA TCTGGAATAA ATGTGCAGTA TTGTAGTATT ACTTTAAGAA CTTTAAGGGA 000840
000841 ACTTCAAAAA CTCACTGAAA TTCTAGTGAG ATACTTTCTT TTTTATTCTT GGTATTTTCC ATATCGGGTG 000910
000911 CAACACTTCA GTTACCAAAT TTCATTGCAC ATAGATTATC TTAGGTACCC TTGGAAATGC ACATTCTTGT 000980
000981 ATCCATCTTA CAGGGGCCCA AGATGATAAA TAGTAAACTC AAAATTGCTC CCCACTCTGT TTATTATTTA 001050
001051 AAGGTGTCAG GATCTGTGTT GTAATGTGTC TACATTAATG TGTTTAGGAG AATACAGGCA TTGGATCATT 001120
001121 TAGTTGATGG AAGTATATGC CAGGCAAGGG AGATAAGGTA TACGACAAGA CTGATGTTTT CAGTATCTTC 001190
001191 TCATGAGGTT GTCAGAGACC TTCATGTCTT CAAAGACTAG TCAGCAAATG AAGTGGTTTA GTGTAGAGAC 001260
001261 AAGATTGGTT GTGTTTTGAT AATTTAAGCT AGGTATTGAG TACATGTGGA TTTTGCTGTC CACAAATACT 001330
001331 TGTTTCAGAG TTTTCATGGA TACAGTGGCA TGGTTGAAAT GAAGCTGTGA GCCTTCTGCT TTAAATCTGA 001400
001401 TGTAAGAAAC TCCTGTTAAC AAATAGTAAG TATGGGTTAA TTAGCCCTTT GATCAAAGCC TAGCTTTACA 001470
001471 TTGTTTAGGA TCTTTGGAAA ACAATTGGTT TGGTTGCCCA CTTTCCGTAG GATCAAGAGC AGAACCTTTC 001540
001541 ACATGGCACA GAAGAACCCA GGTTGCGCTT CATACCTGCA TATTCCAGCC TTAGCCTGCC ATTTCTCTCC 001610
001611 TTGGCACTTT GTGCTCCAGC AACACTGGTC TCAGTTGGTC ATCCTCAAAC TTGGGTTCCA TATCCAGCCT 001680
001681 CAGGACCTCT GTTCCTGTTA CTATGGTTCC TTGCATGTCG CCTGCTCTTA CTAAAGAGCT CGTGTGTTTT 001750
001751 CCAGCACACT TCGGTTTATC TCTTGATGAT GATGCTAGTC TCTCCCTCCG CAAGGGCGGA AAGGCTGCCT 001820
001821 GTTGGTTTGT ACCAGTGTTT CCTAACGTGT AGCTGCAGTC AGTATTTGGC TAAGCTGTTC CCAGGGGCTC 001890
001891 AACAGATGCT TTCGGATGAG CCTTAACTGA CCCAATCCTT TGTGATGCGG GAGAGATTGC TAGGCCTCGC 001960
001961 TCACCTGGCC AGAACCAGGG AAAGAGGCCG CGGTTGCAGC GCGATTCCAG GCCCTGGGCG TCAGGCGCGG 002030
002031 GGTGGGCAGC TCTCCCCGGG CGGTGGGGCC CTTGTGACCG CGAGGCGGGG CGCACCAGGA AGGGAGTGGG 002100
002101 ACAGCGCGGG CGCCCAGGGA TGTGGCCTGG TTACCTGCCT TCTCTGATAC GTCAAGACAC CTTCAACAAT 002170
002171 GGCTTGCAGC TGTACCCTGT TGGCTGCACC CAGGACGCCC TTTTCACTGC TAAGCAGTCC TACCTGAGGC 002240
002241 CCAGGGGCTG CCAGATTGAC CCATAAATAA TCTCCGGCGC CTCAGATCCA GAAGCTGCTG AGCCTGATCT 002310
002311 TAGTGCCTTC TCCTTTCTCT GTGTGGCCCC CCAGCCCCTT TCCCCACTGC CTTGTGTCCA AGGCCCTTTC 002380
002381 CTTCATGTAT CCATGGAGGA GAGACAAAAA TACACATCAA TAAAATAAGA TAGGGAATCC ATAAATAGAC 002450
002451 ATTCAGAAGT ATGGCCAACG GATTTATCTT AAAACCAATG GAGGAAGAAG AGTTTCAATA AATGTTGTGG 002520
002521 ACTTCCATTT GTCAAAGACC AAAACAAAGG AACCCCAACC TTACATGTAA TACAAACTTA ACTCAAAATG 002590
002591 GATCATATAT CTAAATGTAA AATGGAAAGC TATAAAACTG AAAACAGACT ATCTTTACAA CCTAGGCGTA 002660
002661 GGTATAGTTT TTAGACATTA CACCAAAAGC ACATGCCGTA AAAGAAAAAA TAGATAAATT GGTGGATTTC 002730
002731 ATTAAAATTA AAAAACTTTT TCTCTCTGAA AAATCCTGTT AAGCTGGGCG CTGTGGTTCA TGCCTGTAAT 002800
002801 CCCAGCACTT TGGGAGGCTG AGTTGGGAAG AAATTAATAG CTTGAGGCCA GGAGTTCAAG ATCATCCTGG 002870
002871 GCAGCAAAGT CATACACTCT TGAGGGAAGA GAGAGACCTT CTCATATTGT TTTATATTGT TTTATACTCA 002940
002941 GTACCTGTTT TAAGAAAAAA ACAAGGAAGT GAAATCAAAG ACAGGCAGCC CGGCACCAGG CCTGAAACCA 003010
003011 GCCCTGGGCC TGCCTGGCCT AAACCTAGTA GTTAAAAATC AACTTACGAC TTAGAACCTG ATGTTATCCG 003080
003081 TAGATTCCAA GCATTGTATA AAAAAATTGT GAAACTCCCT GTTGTGTTCT GTACCAGTGC ATGAAACCCC 003150
003151 TGTCACATAT CCCCTAGATT GCTCAATCAA TCACGACCCT TTCATGTGAA ATCTTTAGTG TTGTGAGCCC 003220
003221 TTAAAAGGGA CAGAAATTGT GCACTTGAGG AGCTCAGATT TTAAGGCTGT AGCTTGCCGA TGCTCCCAGC 003290
003291 TGAATAAAGC CCTTCCTTCT ACAAAAAAAA AAAAA

Conserved Domains

The Conserved domains of Homo sapiens RPS is displayed as example.

RPS.png

External Links