Difference between revisions of "Gene:SAND"

From ICG
Jump to navigation Jump to search
 
(One intermediate revision by the same user not shown)
Line 2: Line 2:
 
* SAND <=> SAND, CsSAND1, ClSAND
 
* SAND <=> SAND, CsSAND1, ClSAND
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 115: Line 115:
 
|align="center"|2013
 
|align="center"|2013
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>TTGGAACACGTCTTGCCATTAGAGGAGACCAACCATTTCTCTCCTCTCTTTTGAAAAATCTATAACCGAT
 +
TTCTGCAATGGCGACTTCAGATTCGAGGTCTTCTCCTTCATCATCCGACACCGAATTCGCCGATCCAAAT
 +
CCTAGCTCCGATCCAGAGACGAATTCGGAGCGTGTTCAAAGTCAATTAGAGTCAATGAATTTATCTCAAC
 +
CTAGCGAAGTCTCTGATGGTAGCCACACCGAATTTAGCGGTGGCGGCGATGATAATGATGATGAGGTTGC
 +
ATCGGCTAACGGGAACGAAGGCGGAGTTAGCAATGGAGGTTTATTGCGTGAAGGTGTGGCGGGAACTAGC
 +
GGAGGAGAGGTTTTGTTAAGGGCGGAAAATCCGGTGGAAATGGAAGCAGGTGAAGAACCACCGAGTCCGA
 +
CTAGTAGCGGTTACGATGGAGAGAGAGGAAGTAGCGGCGGAGCTACTTCTACTTATAAAGCTGATGATGG
 +
AAGCGAGGATGAGATTAGGGAAGCTAATGTGGATGGTGACACTGCCTCGCAGCATGAAGCTGCGTGGTTG
 +
CCTGGAAAACGCCATGTTGATGAGGATGATGCTTCTACGTCATGGAGAAAGAGGAAGAAGCATTTCTTCA
 +
TACTGAGTAACTCAGGCAAACCGATATATTCCAGATATGGAGATGAACATAAGCTTGCTGGATTTTCGGC
 +
TACTCTTCAAGCTATTATTTCTTTTGTGGAGAATGGTGGTGACCGTGTCAACTTAGTCAAGGCAGGAAAT
 +
CACCAGGTTGTCTTTCTCGTTAAGGGGCCAATATATCTGGTCTGCATCAGCTGTACAGATGAAACATATG
 +
AGTATTTAAGGGGGCAGTTGGATCTTCTATATGGTCAGATGATACTAATTTTAACAAAATCAATAGACAG
 +
ATGTTTTGAAAAGAATGCAAAGTTCGATATGACACCCTTGCTTGGAGGGACAGATGCTGTCTTCTCATCT
 +
CTTGTCCATTCATTTAGCTGGAACCCAGCTACATTTCTTCATGCCTATACTTGTCTTCCCCTTCCATATG
 +
CGTTAAGGCAAGCTACAGGAACCATATTGCAAGAAGTTTGCGCGTCTGGTGTCTTATTCTCACTACTAAT
 +
GTGCAGACACAAGGTTGTCAGTCTTGCTGGTGCACAGAAAGCGTCTCTCCATCCCGATGACTTGCTTCTA
 +
CTCTCAAATTTTGTCATGTCATCAGAATCATTCAGGACATCAGAATCTTTCTCACCAATCTGCCTACCAA
 +
GATACAACGCTCAGGCCTTTTTGCATGCCTATGTCCACTTCTTTGATGATGATACATATGTAATATTGCT
 +
TACCACACGTTCAGATGCGTTCCATCATCTCAAAGATTGCAGGGTACGCCTTGAGGCTGTTCTTCTCAAG
 +
TCAAATATTCTAAGTGTGGTTCAAAGATCAATCGCGGAAGGTGGAATGCGTGTTGAAGATGTACCAATAG
 +
ACCGCAGGCGTCGATCATCTACTACTAATCAAGAACAAGACTCACCTGGTCCCGACATATCTGTGGGAAC
 +
CGGAGGTCCCTTTGGACTTTGGCATTTCATGTACCGTAGTATATACTTAGATCAATACATTTCCTCGGAA
 +
TTCTCACCCCCAGTAACTAGTCACAGACAACAGAAAAGTCTATATCGAGCATACCAGAAACTTTATGCTT
 +
CAATGCATGTAAAAGGATTGGGACCCCACAAGACTCAATATAGAAGAGATGAAAACTACACTCTTCTATG
 +
TTGGGTCACACCAGATTTTGAACTCTATGCAGCATTTGATCCACTTGCAGACAAGGCGATGGCGATAAAG
 +
ATATGCAATCAGGTGTGCCAAAGGGTAAAAGATGTGGAGAATGAAGTGTTCTTGCAAGGAGCTAGTCCTT
 +
TCTCTTGGTGATAATATTTTACTATTCACTCTTTAATATATATGTATTTTTTTTTAATCTTTCTACTGGT
 +
TTGACCCCCTATATTGTGCTAGTACCACCCACCTTAATAAGGCAATAATGTAATTGTACCCAGAAACCCT
 +
TGAGAGAAAGCTATTTCATTGCCTTTATTGTTATTAATTAGCTTGAATAGTCAAAATTGAGATGATGTAG
 +
ACAAAAATTGAAACTATTTGAAAAGTGAGCAATAATATTAAGGTTTTGATGGAAAGAAAAAAAAAAAAAA
 +
AAAAAAAAG</dnaseqindica>|
 +
SOURCE = '''''Arabidopsis thaliana''''' SAND|
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Arabidopsis thaliana''''' SAND|
 +
Str= [[File:SAND.png|center|770px|]]|
 +
 +
 +
}}
 +
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==

Latest revision as of 02:20, 30 August 2017

Synonymous Genes

  • SAND <=> SAND, CsSAND1, ClSAND

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Arabidopsis thaliana SAND
  • Iron Deficiency
2013
Brassica napus SAND
  • Abiotic & Biotic Stress
2014
Camellia sinensis CsSAND1
  • Various Experimental Treatments
2016
Chrysanthemum lavandulifolium SAND
  • Flower Development
2016
Citrullus lanatus ClSAND
  • Fruit Development
2015
Fagopyrum esculentum SAND
  • Different Plant Structures
2011
Festuca arundinacea SAND
  • Abiotic Stresses
2015
Gentiana macrophylla SAND
  • Different Tissue Types & Abiotic Stress
2016
Lilium regale SAND
  • Different Developmental Stages & Abiotic Stress
2016
Pericallis cruenta SAND
  • Flower Development
2013
Peucedanum praeruptorum SAND
  • Abiotic Stresses & Hormone Treatment & Different Tissues
2016
Pyrus pyrifolia SAND
  • Different Tissue & Seasonal Conditions
2014
Vitis vinifera SAND
  • Mycotic Infection
2013

Featured Sequence

The Sequence of Arabidopsis thaliana SAND is displayed as example.

000001 TTGGAACACG TCTTGCCATT AGAGGAGACC AACCATTTCT CTCCTCTCTT TTGAAAAATC TATAACCGAT 000070
000071 TTCTGCAATG GCGACTTCAG ATTCGAGGTC TTCTCCTTCA TCATCCGACA CCGAATTCGC CGATCCAAAT 000140
000141 CCTAGCTCCG ATCCAGAGAC GAATTCGGAG CGTGTTCAAA GTCAATTAGA GTCAATGAAT TTATCTCAAC 000210
000211 CTAGCGAAGT CTCTGATGGT AGCCACACCG AATTTAGCGG TGGCGGCGAT GATAATGATG ATGAGGTTGC 000280
000281 ATCGGCTAAC GGGAACGAAG GCGGAGTTAG CAATGGAGGT TTATTGCGTG AAGGTGTGGC GGGAACTAGC 000350
000351 GGAGGAGAGG TTTTGTTAAG GGCGGAAAAT CCGGTGGAAA TGGAAGCAGG TGAAGAACCA CCGAGTCCGA 000420
000421 CTAGTAGCGG TTACGATGGA GAGAGAGGAA GTAGCGGCGG AGCTACTTCT ACTTATAAAG CTGATGATGG 000490
000491 AAGCGAGGAT GAGATTAGGG AAGCTAATGT GGATGGTGAC ACTGCCTCGC AGCATGAAGC TGCGTGGTTG 000560
000561 CCTGGAAAAC GCCATGTTGA TGAGGATGAT GCTTCTACGT CATGGAGAAA GAGGAAGAAG CATTTCTTCA 000630
000631 TACTGAGTAA CTCAGGCAAA CCGATATATT CCAGATATGG AGATGAACAT AAGCTTGCTG GATTTTCGGC 000700
000701 TACTCTTCAA GCTATTATTT CTTTTGTGGA GAATGGTGGT GACCGTGTCA ACTTAGTCAA GGCAGGAAAT 000770
000771 CACCAGGTTG TCTTTCTCGT TAAGGGGCCA ATATATCTGG TCTGCATCAG CTGTACAGAT GAAACATATG 000840
000841 AGTATTTAAG GGGGCAGTTG GATCTTCTAT ATGGTCAGAT GATACTAATT TTAACAAAAT CAATAGACAG 000910
000911 ATGTTTTGAA AAGAATGCAA AGTTCGATAT GACACCCTTG CTTGGAGGGA CAGATGCTGT CTTCTCATCT 000980
000981 CTTGTCCATT CATTTAGCTG GAACCCAGCT ACATTTCTTC ATGCCTATAC TTGTCTTCCC CTTCCATATG 001050
001051 CGTTAAGGCA AGCTACAGGA ACCATATTGC AAGAAGTTTG CGCGTCTGGT GTCTTATTCT CACTACTAAT 001120
001121 GTGCAGACAC AAGGTTGTCA GTCTTGCTGG TGCACAGAAA GCGTCTCTCC ATCCCGATGA CTTGCTTCTA 001190
001191 CTCTCAAATT TTGTCATGTC ATCAGAATCA TTCAGGACAT CAGAATCTTT CTCACCAATC TGCCTACCAA 001260
001261 GATACAACGC TCAGGCCTTT TTGCATGCCT ATGTCCACTT CTTTGATGAT GATACATATG TAATATTGCT 001330
001331 TACCACACGT TCAGATGCGT TCCATCATCT CAAAGATTGC AGGGTACGCC TTGAGGCTGT TCTTCTCAAG 001400
001401 TCAAATATTC TAAGTGTGGT TCAAAGATCA ATCGCGGAAG GTGGAATGCG TGTTGAAGAT GTACCAATAG 001470
001471 ACCGCAGGCG TCGATCATCT ACTACTAATC AAGAACAAGA CTCACCTGGT CCCGACATAT CTGTGGGAAC 001540
001541 CGGAGGTCCC TTTGGACTTT GGCATTTCAT GTACCGTAGT ATATACTTAG ATCAATACAT TTCCTCGGAA 001610
001611 TTCTCACCCC CAGTAACTAG TCACAGACAA CAGAAAAGTC TATATCGAGC ATACCAGAAA CTTTATGCTT 001680
001681 CAATGCATGT AAAAGGATTG GGACCCCACA AGACTCAATA TAGAAGAGAT GAAAACTACA CTCTTCTATG 001750
001751 TTGGGTCACA CCAGATTTTG AACTCTATGC AGCATTTGAT CCACTTGCAG ACAAGGCGAT GGCGATAAAG 001820
001821 ATATGCAATC AGGTGTGCCA AAGGGTAAAA GATGTGGAGA ATGAAGTGTT CTTGCAAGGA GCTAGTCCTT 001890
001891 TCTCTTGGTG ATAATATTTT ACTATTCACT CTTTAATATA TATGTATTTT TTTTTAATCT TTCTACTGGT 001960
001961 TTGACCCCCT ATATTGTGCT AGTACCACCC ACCTTAATAA GGCAATAATG TAATTGTACC CAGAAACCCT 002030
002031 TGAGAGAAAG CTATTTCATT GCCTTTATTG TTATTAATTA GCTTGAATAG TCAAAATTGA GATGATGTAG 002100
002101 ACAAAAATTG AAACTATTTG AAAAGTGAGC AATAATATTA AGGTTTTGAT GGAAAGAAAA AAAAAAAAAA 002170
002171 AAAAAAAAG

Conserved Domains

The Conserved domains of Arabidopsis thaliana SAND is displayed as example.

SAND.png


External Links