Difference between revisions of "Gene:SDHA"

From ICG
Jump to navigation Jump to search
(Created page with "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* SDHA <=> Sdha, SDHA
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 75: Line 76:
  
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>TCCGGCGTGGTGCGCAGGCGCGGTATCCCCCCTCCCCCGCCAGCTCGACCCCGGTGTGGTGCGCAGGCGC
 +
AGTCTGCGCAGGGACTGGCGGGACTGCGCGGCGGCAACAGCAGACATGTCGGGGGTCCGGGGCCTGTCGC
 +
GGCTGCTGAGCGCTCGGCGCCTGGCGCTGGCCAAGGCGTGGCCAACAGTGTTGCAAACAGGAACCCGAGG
 +
TTTTCACTTCACTGTTGATGGGAACAAGAGGGCATCTGCTAAAGTTTCAGATTCCATTTCTGCTCAGTAT
 +
CCAGTAGTGGATCATGAATTTGATGCAGTGGTGGTAGGCGCTGGAGGGGCAGGCTTGCGAGCTGCATTTG
 +
GCCTTTCTGAGGCAGGGTTTAATACAGCATGTGTTACCAAGCTGTTTCCTACCAGGTCACACACTGTTGC
 +
AGCACAGGGAGGAATCAATGCTGCTCTGGGGAACATGGAGGAGGACAACTGGAGGTGGCATTTCTACGAC
 +
ACCGTGAAGGGCTCCGACTGGCTGGGGGACCAGGATGCCATCCACTACATGACGGAGCAGGCCCCCGCCG
 +
CCGTGGTCGAGCTAGAAAATTATGGCATGCCGTTTAGCAGAACTGAAGATGGGAAGATTTATCAGCGTGC
 +
ATTTGGTGGACAGAGCCTCAAGTTTGGAAAGGGCGGGCAGGCCCATCGGTGCTGCTGTGTGGCTGATCGG
 +
ACTGGCCACTCGCTATTGCACACCTTATATGGAAGGTCTCTGCGATATGATACCAGCTATTTTGTGGAGT
 +
ATTTTGCCTTGGATCTCCTGATGGAGAATGGGGAGTGCCGTGGTGTCATCGCACTGTGCATAGAGGACGG
 +
GTCCATCCATCGCATAAGAGCAAAGAACACTGTTGTTGCCACAGGAGGCTACGGGCGCACCTACTTCAGC
 +
TGCACGTCTGCCCACACCAGCACTGGCGACGGCACGGCCATGATCACCAGGGCAGGCCTTCCTTGCCAGG
 +
ACCTAGAGTTTGTTCAGTTCCACCCTACAGGCATATATGGTGCTGGTTGTCTCATTACGGAAGGATGTCG
 +
TGGAGAGGGAGGCATTCTCATTAACAGTCAAGGCGAAAGGTTTATGGAGCGATACGCCCCTGTCGCGAAG
 +
GACCTGGCGTCTAGAGATGTGGTGTCTCGGTCCATGACTCTGGAGATCCGAGAAGGAAGAGGCTGTGGCC
 +
CTGAGAAAGATCACGTCTACCTGCAGCTGCACCACCTACCTCCAGAGCAGCTGGCCACGCGCCTGCCTGG
 +
CATTTCAGAGACAGCCATGATCTTCGCTGGCGTGGACGTCACGAAGGAGCCGATCCCTGTCCTCCCCACC
 +
GTGCATTATAACATGGGCGGCATTCCCACCAACTACAAGGGGCAGGTCCTGAGGCACGTGAATGGCCAGG
 +
ATCAGATTGTGCCCGGCCTGTACGCCTGTGGGGAGGCCGCCTGTGCCTCGGTACATGGTGCCAACCGCCT
 +
CGGGGCAAACTCGCTCTTGGACCTGGTTGTCTTTGGTCGGGCATGTGCCCTGAGCATCGAAGAGTCATGC
 +
AGGCCTGGAGATAAAGTCCCTCCAATTAAACCAAACGCTGGGGAAGAATCTGTCATGAATCTTGACAAAT
 +
TGAGATTTGCTGATGGAAGCATAAGAACATCGGAACTGCGACTCAGCATGCAGAAGTCAATGCAAAATCA
 +
TGCTGCCGTGTTCCGTGTGGGAAGCGTGTTGCAAGAAGGTTGTGGGAAAATCAGCAAGCTCTATGGAGAC
 +
CTAAAGCACCTGAAGACGTTCGACCGGGGAATGGTCTGGAACACGGACCTGGTGGAGACCCTGGAGCTGC
 +
AGAACCTGATGCTGTGTGCGCTGCAGACCATCTACGGAGCAGAGGCACGGAAGGAGTCACGGGGCGCGCA
 +
TGCCAGGGAAGACTACAAGGTGCGGATTGATGAGTACGATTACTCCAAGCCCATCCAGGGGCAACAGAAG
 +
AAGCCCTTTGAGGAGCACTGGAGGAAGCACACCCTGTCCTATGTGGACGTTGGCACTGGGAAGGTCACTC
 +
TGGAATATAGACCCGTGATCGACAAAACTTTGAACGAGGCTGACTGTGCCACCGTCCCGCCAGCCATTCG
 +
CTCCTACTGATGAGACAAGATGTGGTGATGACAGAATCAGCTTTTGTAATTATGTATAATAGCTCATGCA
 +
TGTGTCCATGTCATAACTGTCTTCATACGCTTCTGCACTCTGGGGAAGAAGGAGTACATTGAAGGGAGAT
 +
TGGCACCTAGTGGCTGGGAGCTTGCCAGGAACCCAGTGGCCAGGGAGCGTGGCACTTACCTTTGTCCCTT
 +
GCTTCATTCTTGTGAGATGATAAAACTGGGCACAGCTCTTAAATAAAATATAAATGAACAAACTTTCTTT
 +
TATTTCCAAAAAAAAAAAAAAAAAA</dnaseqindica>|
 +
SOURCE = '''''Homo sapiens''''' SDHA|
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Homo sapiens''''' SDHA|
 +
Str= [[File:SDHA.png|center|770px|link=Gene:SDHA]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
+
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=COG1053 NCBI Conserved Protein Domain Family]
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
+
* [https://en.wikipedia.org/wiki/SDHA WikiPedia]
* [http://pfam.xfam.org/family/SAND Pfam]
+
* [http://pfam.xfam.org/family/PF00890 Pfam]

Latest revision as of 02:36, 30 August 2017

Synonymous Genes

  • SDHA <=> Sdha, SDHA

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Delomys sublineatus Succinate dehydrogenase complex, subunit A
  • Liver Samples
2010
Equus caballus Succinate dehydrogenase complex subunit A
  • Bronchoalveolar Lavage Cells
2011
Homo sapiens Succinate dehydrogenase complex, subunit A, flavoprotein(Fp)
  • Prostate Cancer Cells
2013
Homo sapiens Succinate dehydrogenase complex, subunit A
  • Cartilage endplate of the lumbar spine
2014
Homo sapiens Succinate dehydrogenase complex, subunit A, flavoprotein
  • Head and Neck Squamous Cell Carcinoma
2009
Homo sapiens Succinate dehydrogenase complex, subunit A
  • Hepatocellular Carcinoma
2008
Mus musculus Succinate dehydrogenase complex, subunit A
  • Embryonic Stem Cells
2011
Rattus norvegicus Succinate dehydrogenase complex, subunit A
  • Eerebral Ischaemia Model
2009

Featured Sequence

The Sequence of Homo sapiens SDHA is displayed as example.

000001 TCCGGCGTGG TGCGCAGGCG CGGTATCCCC CCTCCCCCGC CAGCTCGACC CCGGTGTGGT GCGCAGGCGC 000070
000071 AGTCTGCGCA GGGACTGGCG GGACTGCGCG GCGGCAACAG CAGACATGTC GGGGGTCCGG GGCCTGTCGC 000140
000141 GGCTGCTGAG CGCTCGGCGC CTGGCGCTGG CCAAGGCGTG GCCAACAGTG TTGCAAACAG GAACCCGAGG 000210
000211 TTTTCACTTC ACTGTTGATG GGAACAAGAG GGCATCTGCT AAAGTTTCAG ATTCCATTTC TGCTCAGTAT 000280
000281 CCAGTAGTGG ATCATGAATT TGATGCAGTG GTGGTAGGCG CTGGAGGGGC AGGCTTGCGA GCTGCATTTG 000350
000351 GCCTTTCTGA GGCAGGGTTT AATACAGCAT GTGTTACCAA GCTGTTTCCT ACCAGGTCAC ACACTGTTGC 000420
000421 AGCACAGGGA GGAATCAATG CTGCTCTGGG GAACATGGAG GAGGACAACT GGAGGTGGCA TTTCTACGAC 000490
000491 ACCGTGAAGG GCTCCGACTG GCTGGGGGAC CAGGATGCCA TCCACTACAT GACGGAGCAG GCCCCCGCCG 000560
000561 CCGTGGTCGA GCTAGAAAAT TATGGCATGC CGTTTAGCAG AACTGAAGAT GGGAAGATTT ATCAGCGTGC 000630
000631 ATTTGGTGGA CAGAGCCTCA AGTTTGGAAA GGGCGGGCAG GCCCATCGGT GCTGCTGTGT GGCTGATCGG 000700
000701 ACTGGCCACT CGCTATTGCA CACCTTATAT GGAAGGTCTC TGCGATATGA TACCAGCTAT TTTGTGGAGT 000770
000771 ATTTTGCCTT GGATCTCCTG ATGGAGAATG GGGAGTGCCG TGGTGTCATC GCACTGTGCA TAGAGGACGG 000840
000841 GTCCATCCAT CGCATAAGAG CAAAGAACAC TGTTGTTGCC ACAGGAGGCT ACGGGCGCAC CTACTTCAGC 000910
000911 TGCACGTCTG CCCACACCAG CACTGGCGAC GGCACGGCCA TGATCACCAG GGCAGGCCTT CCTTGCCAGG 000980
000981 ACCTAGAGTT TGTTCAGTTC CACCCTACAG GCATATATGG TGCTGGTTGT CTCATTACGG AAGGATGTCG 001050
001051 TGGAGAGGGA GGCATTCTCA TTAACAGTCA AGGCGAAAGG TTTATGGAGC GATACGCCCC TGTCGCGAAG 001120
001121 GACCTGGCGT CTAGAGATGT GGTGTCTCGG TCCATGACTC TGGAGATCCG AGAAGGAAGA GGCTGTGGCC 001190
001191 CTGAGAAAGA TCACGTCTAC CTGCAGCTGC ACCACCTACC TCCAGAGCAG CTGGCCACGC GCCTGCCTGG 001260
001261 CATTTCAGAG ACAGCCATGA TCTTCGCTGG CGTGGACGTC ACGAAGGAGC CGATCCCTGT CCTCCCCACC 001330
001331 GTGCATTATA ACATGGGCGG CATTCCCACC AACTACAAGG GGCAGGTCCT GAGGCACGTG AATGGCCAGG 001400
001401 ATCAGATTGT GCCCGGCCTG TACGCCTGTG GGGAGGCCGC CTGTGCCTCG GTACATGGTG CCAACCGCCT 001470
001471 CGGGGCAAAC TCGCTCTTGG ACCTGGTTGT CTTTGGTCGG GCATGTGCCC TGAGCATCGA AGAGTCATGC 001540
001541 AGGCCTGGAG ATAAAGTCCC TCCAATTAAA CCAAACGCTG GGGAAGAATC TGTCATGAAT CTTGACAAAT 001610
001611 TGAGATTTGC TGATGGAAGC ATAAGAACAT CGGAACTGCG ACTCAGCATG CAGAAGTCAA TGCAAAATCA 001680
001681 TGCTGCCGTG TTCCGTGTGG GAAGCGTGTT GCAAGAAGGT TGTGGGAAAA TCAGCAAGCT CTATGGAGAC 001750
001751 CTAAAGCACC TGAAGACGTT CGACCGGGGA ATGGTCTGGA ACACGGACCT GGTGGAGACC CTGGAGCTGC 001820
001821 AGAACCTGAT GCTGTGTGCG CTGCAGACCA TCTACGGAGC AGAGGCACGG AAGGAGTCAC GGGGCGCGCA 001890
001891 TGCCAGGGAA GACTACAAGG TGCGGATTGA TGAGTACGAT TACTCCAAGC CCATCCAGGG GCAACAGAAG 001960
001961 AAGCCCTTTG AGGAGCACTG GAGGAAGCAC ACCCTGTCCT ATGTGGACGT TGGCACTGGG AAGGTCACTC 002030
002031 TGGAATATAG ACCCGTGATC GACAAAACTT TGAACGAGGC TGACTGTGCC ACCGTCCCGC CAGCCATTCG 002100
002101 CTCCTACTGA TGAGACAAGA TGTGGTGATG ACAGAATCAG CTTTTGTAAT TATGTATAAT AGCTCATGCA 002170
002171 TGTGTCCATG TCATAACTGT CTTCATACGC TTCTGCACTC TGGGGAAGAA GGAGTACATT GAAGGGAGAT 002240
002241 TGGCACCTAG TGGCTGGGAG CTTGCCAGGA ACCCAGTGGC CAGGGAGCGT GGCACTTACC TTTGTCCCTT 002310
002311 GCTTCATTCT TGTGAGATGA TAAAACTGGG CACAGCTCTT AAATAAAATA TAAATGAACA AACTTTCTTT 002380
002381 TATTTCCAAA AAAAAAAAAA AAAAA

Conserved Domains

The Conserved domains of Homo sapiens SDHA is displayed as example.

SDHA.png

External Links