Difference between revisions of "Gene:Tubulin"

From ICG
Jump to navigation Jump to search
Line 386: Line 386:
 
|align="center"|2013
 
|align="center"|2013
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>GATCTTACAGCCTTGCCCTGCGTTTTCGTTATATAACCGCACATTTCTTGCCAAAATATCTGCGTAGCAC
 +
CCCATACAGACACAAAAATACTCTCCATCTCTTCTTCGATCGAGCCTAGCTCGGGCCCGATCACCGGAAA
 +
AACTCGCATTTCCATCCCCGGCTGCGAATTACTTGACGAAAAACGAAAATGAGAGAAATCCTTCACGTTC
 +
AAGGTGGACAGTGTGGAAATCAGATTGGATCTAAATTTTGGGAGGTCGTTTGCGACGAGCATGGCATTGA
 +
CCCCACTGGACGATACACTGGATCCTCTGATCTGCAGCTGGAGCGCGTTAATGTGTACTACAATGAGGCC
 +
TCCTGTGGGCGATTTGTCCCTCGTGCTGTGCTCATGGATCTTGAGCCTGGTACCATGGACAGTGTGAGGA
 +
CTGGTCCATATGGTCAGATCTTTAGGCCTGATAACTTTGTGTTTGGGCAATCTGGTGCTGGAAATAACTG
 +
GGCCAAGGGGCATTATACTGAGGGAGCTGAGCTGATTGATGCGGTTTTGGATGTTGTGCGGAAGGAGGCT
 +
GAGAACTGTGACTGTCTTCAAGGTTTCCAAGTTTGTCACTCTCTCGGTGGTGGAACTGGTTCTGGAATGG
 +
GAACTCTGTTGATTTCTAAGATCAGGGAGGAATACCCTGACAGAATGATGCTCACATTCTCTGTGTTCCC
 +
TTCACCCAAGGTTTCAGACACTGTGGTTGAGCCCTATAATGCCACCCTTTCTGTACATCAACTAGTTGAG
 +
AACGCTGATGAGTGTATGGTACTTGACAATGAGGCCTTGTATGACATTTGTTTCAGGACTCTCAAGTTAA
 +
CTACTCCCAGCTTTGGTGATCTGAACCACCTGATCTCTGCAACTATGAGTGGAGTCACTTGCTGCCTGAG
 +
GTTCCCTGGTCAGCTTAACTCTGATCTCAGGAAGCTTGCAGTGAATCTTATCCCCTTCCCCCGATTGCAC
 +
TTCTTTATGGTTGGATTTGCTCCTTTAACATCACGTGGTTCTCAACAATACCGTGCGCTAACTGTCCCAG
 +
AACTGACCCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCTGCAGACCCACGCCACGGGCGCTACTT
 +
GACTGCCTCAGCCATGTTCAGGGGTAAGATGAGCACAAAGGAAGTCGACGAACAAATGATCAATGTCCAG
 +
AACAAGAACTCCTCATACTTCGTTGAATGGATCCCTAACAATGTCAAGTCTAGTGTCTGTGATATCCCTC
 +
CTAGAGGACTTTCTATGGCATCAACTTTCATCGGTAACTCAACTTCAATCCAGGAAATGTTCAGGCGTGT
 +
CAGCGAGCAATTCACAGCCATGTTTAGGAGAAAGGCTTTCTTGCATTGGTATACCGGTGAAGGGATGGAT
 +
GAAATGGAGTTTACCGAGGCCGAAAGCAACATGAATGATCTTGTGTCTGAATATCAGCAATACCAGGATG
 +
CTACAGCTGAGGAGGAGCTTGAATATGAGGATGAAGAGGAAGGGATGGGTGAAATGCAATGAGCTATGAG
 +
GTGACCTTTTCTATTGGCATTTACAGCAAATGTTATACCTTAATATATAGCTTCTGCTTTTTTGTGGAAC
 +
ATGGGTGATGAATTTTTTCAATGTATGAGGTAGTGTTTGGATAGAGTTGAAAAAGTGAATCTTCCTAGTA
 +
AATGAGTATATGTTTGTAATGTGGGAGGTGAAAAAGGTTATTTTGTATTTCTGTTGAAGCTCAATTCTGG
 +
CTTTGGTTTCATATCCATTTCTATAAATATAATGAAGTTCTTTATGTAAGTCCTTGA</dnaseqindica>|
 +
SOURCE = '''''Artemisia annua''''' Tubulin|
 +
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Artemisia annua''''' Tubulin|
 +
Str= [[File:|center|770px|]]|
 +
 +
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==

Revision as of 07:52, 9 August 2017

Synonymous Genes

Experimental Validated ICGs

Species Gene Synonymous Application scenarios Publication Year
Arachis hypogaea Alpha tubulin
  • Different Developmental Stages & Abiotic Stress
2012
Artemisia annua Tubulin beta chain
  • Different Tissues & Abiotic Stress
2014
Bemisia tabaci Tubulin alpha-1 chain
  • Different Commercially Available Insecticides
2014
Brassica rapa subsp. pekinensis Tubulin a
  • Different Developmental Stages & Biotic Stress
2012
Bactrocera dorsalis Alpha tubulin
  • Different Sex & Tissues
2010
Buglossoides arvensis Alpha tubulin
  • Different Tissues & Growth Regimes
2015
Caenorhabditis elegans Tubulin, alpha family member
  • Nanotoxicity
2012
Cajanus cajan Tubulin/FtsZ family, GTPase domain
  • Drought Stress
2015
Capsicum annuum Beta tubulin
  • Different Tissues & Abiotic Stress & Hormonal Treatment
2011
Channa striatus alpha-tubulin
  • High-temperature Stress
2016
Citrullus lanatus Alpha tubulin 5
  • Fruit Development
2015
Corchorus capsularis Beta-tubulin
  • Different Tissues & Abiotic Stress
2015
Cucumis sativus α-Tubulin
  • Different Tissues & Hormones Treatment & abiotic stresses
2010
Cynodon dactylon Alpha tubulin
  • Abiotic Stress
2014
Diploptera punctata α-tubulin
  • During Gonadotrophic Cycle
2013
Drosophila melanogaster Alpha-tubulin at 84B
  • Physiological Responses
2011
Eremosparton songoricum Alpha-tubulin
  • Different Tissues & Abiotic Stress
2012
Festuca arundinacea Alpha Tubulin
  • Abiotic Stresses
2015
Ganoderma lucidum β-tubulin
  • Different Tissues & Developmental Stages
2014
Glycine max Tubulin alpha-4
  • Heavy Metals & Heat Treatments
2017
Glycine max Tubulin alpha-4, Tubulin beta-4
  • Biotic Stresses
2015
Gossypium hirsutum Alpha-tubulin 10
  • Abiotic Stress
2013
Hibiscus cannabinus Alpha-tubulin
  • Salinity & Drought Stress
2015
Jatropha curcas Tubulin beta-5 chain
  • Staminate & Pistillate Flowers
2017
Litsea cubeba Tubulin alpha
  • Different Developmental Stages & Tissues
2013
Lucilia cuprina β-tubulin
  • Different Developmental Stages
2010
Mus musculus Alpha 1a tubulin
  • Lung Development
2015
Neurospora crassa Beta-tubulin
  • Different Environmental Conditions
2014
Nilaparvata lugens A-tubulin
  • Different Experimental Conditions
2014
Octopus vulgaris α-tubulin
  • Brain
2009
Paralichthys olivaceus α -tubulin
  • Before & After Bacterial Infection
2011
Paralichthys olivaceus α-tubulin
  • Viral Infection
2013
Phytophthora parasitica β-tubulin
  • Different Developmental Stages
2006
Pinus massoniana Tubulin alpha
  • Different Tissues & Floral Organ Development & Abiotic Stress
2016
Poa pratensis Alpha tubulin-2B
  • Alpha tubulin-2B
2015
Rhodnius prolixus α-tubulin
  • Different Experimental Conditions
2012
Ruditapes philippinarum Ruditapes philippinarum
  • Copper Treated
2017
Saccharum hybrid cultivar Alpha-tubulin
  • Drought Stress
2014
Scophthalmus maximus α-tubulin
  • Viral Infection
2013
Sedum alfredii Beta-tubulin
  • Different Heavy Metals Stresses
2013
Sesamia inferens ubulin
  • Different Tissues & Developmental Stages
2015
Sesamum indicum Sesamum indicum
  • Different Developmental Stages & Abiotic Stress
2013
Syntrichia caninervis Alpha-tubulin
  • Abiotic Stress and Desiccation/Rehydration
2015
Triticum aestivum B-Tubulin
  • Rust Infection
2013
Ulva linza Tubulin2
  • Different Experimental Conditions
2012
Zea mays Beta-5 tubulin
  • Abiotic Stresses & Hormone Treatment & Tissue Types
2014
Zea mays Beta-5 tubulin
  • Landrace Varieties & During Grain Development
2013

Featured Sequence

The Sequence of Artemisia annua Tubulin is displayed as example.

000001 GATCTTACAG CCTTGCCCTG CGTTTTCGTT ATATAACCGC ACATTTCTTG CCAAAATATC TGCGTAGCAC 000070
000071 CCCATACAGA CACAAAAATA CTCTCCATCT CTTCTTCGAT CGAGCCTAGC TCGGGCCCGA TCACCGGAAA 000140
000141 AACTCGCATT TCCATCCCCG GCTGCGAATT ACTTGACGAA AAACGAAAAT GAGAGAAATC CTTCACGTTC 000210
000211 AAGGTGGACA GTGTGGAAAT CAGATTGGAT CTAAATTTTG GGAGGTCGTT TGCGACGAGC ATGGCATTGA 000280
000281 CCCCACTGGA CGATACACTG GATCCTCTGA TCTGCAGCTG GAGCGCGTTA ATGTGTACTA CAATGAGGCC 000350
000351 TCCTGTGGGC GATTTGTCCC TCGTGCTGTG CTCATGGATC TTGAGCCTGG TACCATGGAC AGTGTGAGGA 000420
000421 CTGGTCCATA TGGTCAGATC TTTAGGCCTG ATAACTTTGT GTTTGGGCAA TCTGGTGCTG GAAATAACTG 000490
000491 GGCCAAGGGG CATTATACTG AGGGAGCTGA GCTGATTGAT GCGGTTTTGG ATGTTGTGCG GAAGGAGGCT 000560
000561 GAGAACTGTG ACTGTCTTCA AGGTTTCCAA GTTTGTCACT CTCTCGGTGG TGGAACTGGT TCTGGAATGG 000630
000631 GAACTCTGTT GATTTCTAAG ATCAGGGAGG AATACCCTGA CAGAATGATG CTCACATTCT CTGTGTTCCC 000700
000701 TTCACCCAAG GTTTCAGACA CTGTGGTTGA GCCCTATAAT GCCACCCTTT CTGTACATCA ACTAGTTGAG 000770
000771 AACGCTGATG AGTGTATGGT ACTTGACAAT GAGGCCTTGT ATGACATTTG TTTCAGGACT CTCAAGTTAA 000840
000841 CTACTCCCAG CTTTGGTGAT CTGAACCACC TGATCTCTGC AACTATGAGT GGAGTCACTT GCTGCCTGAG 000910
000911 GTTCCCTGGT CAGCTTAACT CTGATCTCAG GAAGCTTGCA GTGAATCTTA TCCCCTTCCC CCGATTGCAC 000980
000981 TTCTTTATGG TTGGATTTGC TCCTTTAACA TCACGTGGTT CTCAACAATA CCGTGCGCTA ACTGTCCCAG 001050
001051 AACTGACCCA GCAAATGTGG GATGCCAAGA ACATGATGTG TGCTGCAGAC CCACGCCACG GGCGCTACTT 001120
001121 GACTGCCTCA GCCATGTTCA GGGGTAAGAT GAGCACAAAG GAAGTCGACG AACAAATGAT CAATGTCCAG 001190
001191 AACAAGAACT CCTCATACTT CGTTGAATGG ATCCCTAACA ATGTCAAGTC TAGTGTCTGT GATATCCCTC 001260
001261 CTAGAGGACT TTCTATGGCA TCAACTTTCA TCGGTAACTC AACTTCAATC CAGGAAATGT TCAGGCGTGT 001330
001331 CAGCGAGCAA TTCACAGCCA TGTTTAGGAG AAAGGCTTTC TTGCATTGGT ATACCGGTGA AGGGATGGAT 001400
001401 GAAATGGAGT TTACCGAGGC CGAAAGCAAC ATGAATGATC TTGTGTCTGA ATATCAGCAA TACCAGGATG 001470
001471 CTACAGCTGA GGAGGAGCTT GAATATGAGG ATGAAGAGGA AGGGATGGGT GAAATGCAAT GAGCTATGAG 001540
001541 GTGACCTTTT CTATTGGCAT TTACAGCAAA TGTTATACCT TAATATATAG CTTCTGCTTT TTTGTGGAAC 001610
001611 ATGGGTGATG AATTTTTTCA ATGTATGAGG TAGTGTTTGG ATAGAGTTGA AAAAGTGAAT CTTCCTAGTA 001680
001681 AATGAGTATA TGTTTGTAAT GTGGGAGGTG AAAAAGGTTA TTTTGTATTT CTGTTGAAGC TCAATTCTGG 001750
001751 CTTTGGTTTC ATATCCATTT CTATAAATAT AATGAAGTTC TTTATGTAAG TCCTTGA

Conserved Domains

The Conserved domains of Artemisia annua Tubulin is displayed as example. [[File:|center|770px|]]

External Links