Difference between revisions of "Gene:YLS8"

From ICG
Jump to navigation Jump to search
(Created page with "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
Line 51: Line 51:
  
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>AACGCTTTATGCGGTTCACGCGTGGAATCGACGCGCCGTCACCGTCAACAAAATTGGGAAGAGAATATAA
 +
AATTAGGGCAAGAGAGAAAAAAGGTTGAATCGAAACAGATCGGAAAATCGTCGAGAGAGAGAGAGAGAGA
 +
GAGAATGTCGTATCTTCTTCCACATCTGCACTCCGGTTGGGCTGTTGATCAGTCGATTCTGGCCGAGGAA
 +
GAGCGTCTCGTCGTCATTCGTTTCGGCCATGACTGGGATGAGACCTGTATGCAGATGGATGAGGTGCTTG
 +
CGTCTGTTGCTGAGACGATTAAGAACTTTGCAGTCATTTATCTGGTGGACATCACTGAGGTTCCAGACTT
 +
CAACACCATGTACGAGCTGTACGATCCTTCTACGGTCATGTTCTTCTTCAGGAACAAGCACATCATGATC
 +
GATCTTGGAACTGGTAACAACAACAAGATCAACTGGGCTCTCAAGGACAAGCAGGAGTTCATTGATATCA
 +
TTGAGACTGTCTACCGTGGTGCAAGGAAGGGTCGTGGGTTGGTGATTGCTCCAAAAGATTACTCCACCAA
 +
ATACCGTTACTAATCGAGCTTCCCAACACTATCTAGTTTGTTAAAACCATTGAGTCTAGTGATTCTGGTC
 +
AGCTGAAATATCCCGTGAACTGGTTTCATTTCATATATGCTTTGATGATGATTGTGATTCTGGTTTTTGC
 +
TTACTGTTTCGGTTGTTCTCCATTTATGTATGTAACTACTTGCTTCGAACATGATTCAGTGAAATGAAAT
 +
TTGGAAGCCGTTGGGTTTATGTATATGCATCTTTGATCTTCCTGGGTTATGTATATGTGACACCATTTGT
 +
CTACCAAGTACCAACGATGGATACGAAAATGAAACTTTTTACTA</dnaseqindica>|
 +
SOURCE = '''''Humulus lupulus''''' YLS8|
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Humulus lupulus''''' YLS8|
 +
Str= [[File:YLS8.png|center|770px|]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==

Revision as of 02:11, 10 August 2017

Synonymous Genes

Experimental Validated ICGs

Species Gene Synonymous Application scenarios Publication Year
Arabidopsis thaliana Mitosis protein YLS8
  • Iron Deficiency
2013
Craterostigma plantagineum Yellow-Leaf-Specific gene 8
  • Different Tissues
2015
Hevea brasiliensis Mitosis protein
  • Different Genotypes & Abiotic Stress
2011
Humulus lupulus Yellow leaf specific protein 8
  • Bacteria Infection
2013
Trifolium pratense Yellow-leaf-specific protein 8
  • Different Tissues
2012

Featured Sequence

The Sequence of Humulus lupulus YLS8 is displayed as example.

000001 AACGCTTTAT GCGGTTCACG CGTGGAATCG ACGCGCCGTC ACCGTCAACA AAATTGGGAA GAGAATATAA 000070
000071 AATTAGGGCA AGAGAGAAAA AAGGTTGAAT CGAAACAGAT CGGAAAATCG TCGAGAGAGA GAGAGAGAGA 000140
000141 GAGAATGTCG TATCTTCTTC CACATCTGCA CTCCGGTTGG GCTGTTGATC AGTCGATTCT GGCCGAGGAA 000210
000211 GAGCGTCTCG TCGTCATTCG TTTCGGCCAT GACTGGGATG AGACCTGTAT GCAGATGGAT GAGGTGCTTG 000280
000281 CGTCTGTTGC TGAGACGATT AAGAACTTTG CAGTCATTTA TCTGGTGGAC ATCACTGAGG TTCCAGACTT 000350
000351 CAACACCATG TACGAGCTGT ACGATCCTTC TACGGTCATG TTCTTCTTCA GGAACAAGCA CATCATGATC 000420
000421 GATCTTGGAA CTGGTAACAA CAACAAGATC AACTGGGCTC TCAAGGACAA GCAGGAGTTC ATTGATATCA 000490
000491 TTGAGACTGT CTACCGTGGT GCAAGGAAGG GTCGTGGGTT GGTGATTGCT CCAAAAGATT ACTCCACCAA 000560
000561 ATACCGTTAC TAATCGAGCT TCCCAACACT ATCTAGTTTG TTAAAACCAT TGAGTCTAGT GATTCTGGTC 000630
000631 AGCTGAAATA TCCCGTGAAC TGGTTTCATT TCATATATGC TTTGATGATG ATTGTGATTC TGGTTTTTGC 000700
000701 TTACTGTTTC GGTTGTTCTC CATTTATGTA TGTAACTACT TGCTTCGAAC ATGATTCAGT GAAATGAAAT 000770
000771 TTGGAAGCCG TTGGGTTTAT GTATATGCAT CTTTGATCTT CCTGGGTTAT GTATATGTGA CACCATTTGT 000840
000841 CTACCAAGTA CCAACGATGG ATACGAAAAT GAAACTTTTT ACTA

Conserved Domains

The Conserved domains of Humulus lupulus YLS8 is displayed as example.

YLS8.png

External Links