Difference between revisions of "Gene:YWHAZ"

From ICG
Jump to navigation Jump to search
(Created page with "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
Line 67: Line 67:
  
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>GACACAGATCCGCCATGACAAAGGAGGAGAGTCGGGGACTTGAGCCGTGGCTCCGACTTGGGCGGAGCCT
 +
GGAGGGGGGTGGTTGCGATACGCGGACCGGAGAATTTGCACTTTAAAGTCCGGGTCTGCCCGTTTTCGTT
 +
TCACAGTAACCGACGTCTCAAGTCAGAACATCCAGTCATGGATAAAAATGAGCTGGTTCAGAAGGCCAAA
 +
CTGGCCGAGCAGGCTGAGCGATATGATGACATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTG
 +
AATTATCCAATGAGGAGAGGAATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATC
 +
TTGGAGGGTCGTCTCAAGTATTGAACAAAAGACGGAAGGTGCTGAGAAAAAACAGCAGATGGCTCGAGAA
 +
TACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTGGAAAAGTTCT
 +
TGATCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATGAAAGGAGATTACTACCGTTA
 +
CTTGGCTGAGGTTGCCGCTGGTGATGACAAGAAAGGGATTGTCGATCAGTCACAACAAGCATACCAAGAA
 +
GCTTTTGAAATCAGCAAAAAGGAAATGCAACCAACACATCCTATCAGACTGGGTCTGGCCCTTAACTTCT
 +
CTGTGTTCTATTATGAGATTCTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGA
 +
AGCCATTGCTGAACTTGATACATTAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTG
 +
AGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGCAGGAGAAGGAGGGGAAA
 +
ATTAACCGGCCTTCCAACTTTTGTCTGCCTCATTCTAAAATTTACACAGTAGACCATTTGTCATCCATGC
 +
TGTCCCACAAATAGTTTTTTGTTTACGATTTATGACAGGTTTATGTTACTTCTATTTGAATTTCTATATT
 +
TCCCATGTGGTTTTTATGTTTAATATTAGGGGAGTAGAGCCAGTTAACATTTAGGGAGTTATCTGTTTTC
 +
ATCTTGAGGTGGCCAATATGGGGATGTGGAATTTTTATACAAGTTATAAGTGTTTGGCATAGTACTTTTG
 +
GTACATTGTGGCTTCAAAAGGGCCAGTGTAAAACTGCTTCCATGTCTAAGCAAAGAAAACTGCCTACATA
 +
CTGGTTTGTCCTGGCGGGGAATAAAAGGGATCATTGGTTCCAGTCACAGGTGTAGTAATTGTGGGTACTT
 +
TAAGGTTTGGAGCACTTACAAGGCTGTGGTAGAATCATACCCCATGGATACCACATATTAAACCATGTAT
 +
ATCTGTGGAATACTCAATGTGTACACCTTTGACTACAGCTGCAGAAGTGTTCCTTTAGACAAAGTTGTGA
 +
CCCATTTTACTCTGGATAAGGGCAGAAACGGTTCACATTCCATTATTTGTAAAGTTACCTGCTGTTAGCT
 +
TTCATTATTTTTGCTACACTCATTTTATTTGTATTTAAATGTTTTAGGCAACCTAAGAACAAATGTAAAA
 +
GTAAAGATGCAGGAAAAATGAATTGCTTGGTATTCATTACTTCATGTATATCAAGCACAGCAGTAAAACA
 +
AAAACCCATGTATTTAACTTTTTTTTAGGATTTTTGCTTTTGTGATTTTTTTTTTTTTGATACTTGCCTA
 +
ACATGCATGTGCTGTAAAAATAGTTAACAGGGAAATAACTTGAGATGATGGCTAGCTTTGTTTAATGTCT
 +
TATGAAATTTTCATGAACAATCCAAGCATAATTGTTAAGAACACGTGTATTAAATTCATGTAAGTGGAAT
 +
AAAAGTTTTATGAATGGACTTTTCAACTACTTTCTCTACAGCTTTTCATGTAAATTAGTCTTGGTTCTGA
 +
AACTTCTCTAAAGGAAATTGTACATTTTTTGAAATTTATTCCTTATTCCCTCTTGGCAGCTAATGGGCTC
 +
TTACCAAGTTTAAACACAAAATTTATCATAACAAAAATACTACTAATATAACTACTGTTTCCATGTCCCA
 +
TGATCCCCTCTCTTCCTCCCCACCCTGAAAAAAATGAGTTCCTATTTTTTCTGGGAGAGGGGGGGATTGA
 +
TTAGAAAAAAATGTAGTGTGTTCCATTTAAAATTTTGGCATATGGCATTTTCTAACTTAGGAAGCCACAA
 +
TGTTCTTGGCCCATCATGACATTGGGTAGCATTAACTGTAAGTTTTGTGCTTCCAAATCACTTTTTGGTT
 +
TTTAAGAATTTCTTGATACTCTTATAGCCTGCCTTCAATTTTGATCCTTTATTCTTTCTATTTGTCAGGT
 +
GCACAAGATTACCTTCCTGTTTTAGCCTTCTGTCTTGTCACCAACCATTCTTACTTGGTGGCCATGTACT
 +
TGGAAAAAGGCCGCATGATCTTTCTGGCTCCACTCAGTGTCTAAGGCACCCTGCTTCCTTTGCTTGCATC
 +
CCACAGACTATTTCCCTCATCCTATTTACTGCAGCAAATCTCTCCTTAGTTGATGAGACTGTGTTTATCT
 +
CCCTTTAAAACCCTACCTATCCTGAATGGTCTGTCATTGTCTGCCTTTAAAATCCTTCCTCTTTCTTCCT
 +
CCTCTATTCTCTAAATAATGATGGGGCTAAGTTATACCCAAAGCTCACTTTACAAAATATTTCCTCAGTA
 +
CTTTGCAGAAAACACCAAACAAAAATGCCATTTTAAAAAAGGTGTATTTTTTCTTTTAGAATGTAAGCTC
 +
CTCAAGAGCAGGGACAATGTTTTCTGTATGTTCTATTGTGCCTAGTACACTGTAAATGCTCAATAAATAT
 +
TGATGATGGGAGGCAGTGAGTCTTGATGATAAGGGTGAGAAACTGAAATCCCAAACACTGTTTTGTTGCT
 +
TGTTTTATTATGACCTCAGATTAAATTGGGAAATATTGGCCCTTTTGAATAATTGTCCCAAATATTACAT
 +
TCAAATAAAAGTGCAATGGAGAAAAAAAAAAA
 +
</dnaseqindica>|
 +
SOURCE = '''''Homo sapiens''''' YWHAZ|
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Homo sapiens''''' YWHAZ|
 +
Str= [[File:YWHAZ.png|center|770px|]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==

Revision as of 01:27, 10 August 2017

Synonymous Genes

Experimental Validated ICGs

Species Gene Synonymous Application scenarios Publication Year
Felis catus Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
  • Snap-Frozen Tissues
2007
Homo sapiens Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Mesenchymal Stromal Cells
2014
Homo sapiens Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide
  • Umbilical Vein Endothelial Cells
2013
Mus musculus 14-3-3 protein zeta/delta (14-3-3ζ)
  • Preimplantation Embryos
2014
Mus musculus Tyrosine 3-monooxygenase /tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Embryonic Stem Cells
2011
Rattus norvegicus Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Eerebral Ischaemia Model
2009
Stenella coeruleoalba Tyrosine 3-monooxygenase
  • Striped Dolphin Skin
2006

Featured Sequence

The Sequence of Homo sapiens YWHAZ is displayed as example.

000001 GACACAGATC CGCCATGACA AAGGAGGAGA GTCGGGGACT TGAGCCGTGG CTCCGACTTG GGCGGAGCCT 000070
000071 GGAGGGGGGT GGTTGCGATA CGCGGACCGG AGAATTTGCA CTTTAAAGTC CGGGTCTGCC CGTTTTCGTT 000140
000141 TCACAGTAAC CGACGTCTCA AGTCAGAACA TCCAGTCATG GATAAAAATG AGCTGGTTCA GAAGGCCAAA 000210
000211 CTGGCCGAGC AGGCTGAGCG ATATGATGAC ATGGCAGCCT GCATGAAGTC TGTAACTGAG CAAGGAGCTG 000280
000281 AATTATCCAA TGAGGAGAGG AATCTTCTCT CAGTTGCTTA TAAAAATGTT GTAGGAGCCC GTAGGTCATC 000350
000351 TTGGAGGGTC GTCTCAAGTA TTGAACAAAA GACGGAAGGT GCTGAGAAAA AACAGCAGAT GGCTCGAGAA 000420
000421 TACAGAGAGA AAATTGAGAC GGAGCTAAGA GATATCTGCA ATGATGTACT GTCTCTTTTG GAAAAGTTCT 000490
000491 TGATCCCCAA TGCTTCACAA GCAGAGAGCA AAGTCTTCTA TTTGAAAATG AAAGGAGATT ACTACCGTTA 000560
000561 CTTGGCTGAG GTTGCCGCTG GTGATGACAA GAAAGGGATT GTCGATCAGT CACAACAAGC ATACCAAGAA 000630
000631 GCTTTTGAAA TCAGCAAAAA GGAAATGCAA CCAACACATC CTATCAGACT GGGTCTGGCC CTTAACTTCT 000700
000701 CTGTGTTCTA TTATGAGATT CTGAACTCCC CAGAGAAAGC CTGCTCTCTT GCAAAGACAG CTTTTGATGA 000770
000771 AGCCATTGCT GAACTTGATA CATTAAGTGA AGAGTCATAC AAAGACAGCA CGCTAATAAT GCAATTACTG 000840
000841 AGAGACAACT TGACATTGTG GACATCGGAT ACCCAAGGAG ACGAAGCTGA AGCAGGAGAA GGAGGGGAAA 000910
000911 ATTAACCGGC CTTCCAACTT TTGTCTGCCT CATTCTAAAA TTTACACAGT AGACCATTTG TCATCCATGC 000980
000981 TGTCCCACAA ATAGTTTTTT GTTTACGATT TATGACAGGT TTATGTTACT TCTATTTGAA TTTCTATATT 001050
001051 TCCCATGTGG TTTTTATGTT TAATATTAGG GGAGTAGAGC CAGTTAACAT TTAGGGAGTT ATCTGTTTTC 001120
001121 ATCTTGAGGT GGCCAATATG GGGATGTGGA ATTTTTATAC AAGTTATAAG TGTTTGGCAT AGTACTTTTG 001190
001191 GTACATTGTG GCTTCAAAAG GGCCAGTGTA AAACTGCTTC CATGTCTAAG CAAAGAAAAC TGCCTACATA 001260
001261 CTGGTTTGTC CTGGCGGGGA ATAAAAGGGA TCATTGGTTC CAGTCACAGG TGTAGTAATT GTGGGTACTT 001330
001331 TAAGGTTTGG AGCACTTACA AGGCTGTGGT AGAATCATAC CCCATGGATA CCACATATTA AACCATGTAT 001400
001401 ATCTGTGGAA TACTCAATGT GTACACCTTT GACTACAGCT GCAGAAGTGT TCCTTTAGAC AAAGTTGTGA 001470
001471 CCCATTTTAC TCTGGATAAG GGCAGAAACG GTTCACATTC CATTATTTGT AAAGTTACCT GCTGTTAGCT 001540
001541 TTCATTATTT TTGCTACACT CATTTTATTT GTATTTAAAT GTTTTAGGCA ACCTAAGAAC AAATGTAAAA 001610
001611 GTAAAGATGC AGGAAAAATG AATTGCTTGG TATTCATTAC TTCATGTATA TCAAGCACAG CAGTAAAACA 001680
001681 AAAACCCATG TATTTAACTT TTTTTTAGGA TTTTTGCTTT TGTGATTTTT TTTTTTTTGA TACTTGCCTA 001750
001751 ACATGCATGT GCTGTAAAAA TAGTTAACAG GGAAATAACT TGAGATGATG GCTAGCTTTG TTTAATGTCT 001820
001821 TATGAAATTT TCATGAACAA TCCAAGCATA ATTGTTAAGA ACACGTGTAT TAAATTCATG TAAGTGGAAT 001890
001891 AAAAGTTTTA TGAATGGACT TTTCAACTAC TTTCTCTACA GCTTTTCATG TAAATTAGTC TTGGTTCTGA 001960
001961 AACTTCTCTA AAGGAAATTG TACATTTTTT GAAATTTATT CCTTATTCCC TCTTGGCAGC TAATGGGCTC 002030
002031 TTACCAAGTT TAAACACAAA ATTTATCATA ACAAAAATAC TACTAATATA ACTACTGTTT CCATGTCCCA 002100
002101 TGATCCCCTC TCTTCCTCCC CACCCTGAAA AAAATGAGTT CCTATTTTTT CTGGGAGAGG GGGGGATTGA 002170
002171 TTAGAAAAAA ATGTAGTGTG TTCCATTTAA AATTTTGGCA TATGGCATTT TCTAACTTAG GAAGCCACAA 002240
002241 TGTTCTTGGC CCATCATGAC ATTGGGTAGC ATTAACTGTA AGTTTTGTGC TTCCAAATCA CTTTTTGGTT 002310
002311 TTTAAGAATT TCTTGATACT CTTATAGCCT GCCTTCAATT TTGATCCTTT ATTCTTTCTA TTTGTCAGGT 002380
002381 GCACAAGATT ACCTTCCTGT TTTAGCCTTC TGTCTTGTCA CCAACCATTC TTACTTGGTG GCCATGTACT 002450
002451 TGGAAAAAGG CCGCATGATC TTTCTGGCTC CACTCAGTGT CTAAGGCACC CTGCTTCCTT TGCTTGCATC 002520
002521 CCACAGACTA TTTCCCTCAT CCTATTTACT GCAGCAAATC TCTCCTTAGT TGATGAGACT GTGTTTATCT 002590
002591 CCCTTTAAAA CCCTACCTAT CCTGAATGGT CTGTCATTGT CTGCCTTTAA AATCCTTCCT CTTTCTTCCT 002660
002661 CCTCTATTCT CTAAATAATG ATGGGGCTAA GTTATACCCA AAGCTCACTT TACAAAATAT TTCCTCAGTA 002730
002731 CTTTGCAGAA AACACCAAAC AAAAATGCCA TTTTAAAAAA GGTGTATTTT TTCTTTTAGA ATGTAAGCTC 002800
002801 CTCAAGAGCA GGGACAATGT TTTCTGTATG TTCTATTGTG CCTAGTACAC TGTAAATGCT CAATAAATAT 002870
002871 TGATGATGGG AGGCAGTGAG TCTTGATGAT AAGGGTGAGA AACTGAAATC CCAAACACTG TTTTGTTGCT 002940
002941 TGTTTTATTA TGACCTCAGA TTAAATTGGG AAATATTGGC CCTTTTGAAT AATTGTCCCA AATATTACAT 003010
003011 TCAAATAAAA GTGCAATGGA GAAAAAAAAA AA

Conserved Domains

The Conserved domains of Homo sapiens YWHAZ is displayed as example.

YWHAZ.png

External Links