Difference between revisions of "Gluconacetobacter diazotrophicus"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Gluconacetobacter diazotrophicus-1.jpg|right|200px|link=Gluconacetobacter diazotrophicus]]
 
[[File:Gluconacetobacter diazotrophicus-1.jpg|right|200px|link=Gluconacetobacter diazotrophicus]]
*'''''Gluconacetobacter diazotrophicus''''' is a strict aerobic N2-fixing endophyte, originally isolated from roots and shoots of sugarcane plants grown in Brazil and in other countries such as Argentina, Uruguay, Mexico, Cuba, United States, India and Canada. G. diazotrophicus has been mainly found colonizing plants such as Pennisetum purpureum Schum, Ipomea batatas Lamb, Coffea arabica L, Ananas comosus L. Polycarpon succulentum L., Fagonia arabica L., and Malva parviflora L. (Madhaiyan et al., 2004). Recently, the existence of G. diazotrophicus was reported in the rhizo-and-phyllo spheres of a number of desert plants in Sinai environment. This bacteria species is capable of oxidizing ethanol to acetic acid, tolerate high concentrations of glucose  and to convert N2 to NH3 through biological nitrogen fixation. In addition, G. diazotrophicus can also promote biomass gain induced by hormone and/or siderophore production. In 2009 the genome of G. diazotrophicus strain PAL5 was completely sequenced by Bertalan et al.  and genes involved in nitrogen fixation, sugar metabolism, transport systems, biosynthesis of polysaccharides, quorum sensing and auxin biosynthesis were identified. The genome data are an important source of information that can be used to understand plant–bacteria interactions which could improve productivity of sugarcane and other biotechnological applications.<ref name="ref1"/><ref name="ref2"/>.
+
*'''''Gluconacetobacter diazotrophicus''''' strain PAL5 is a nitrogen-fixing endophytic bacterium originally isolated from sugarcane and later on was found to colonize other plants such as rice, elephant grass, sweet potato, coffee, and pineapple. Currently, G. diazotrophicus has been considered a plant growth-promoting bacterium due to its characteristics of biological nitrogen fixation, phytohormone secretion, solubilization of mineral nutrients and antagonism to phytopathogens <ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''NA'''
 
* <font color=blue>'''Common Name:'''</font> '''NA'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=33996 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=33996 <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 06:03, 10 August 2017

Description

Gluconacetobacter diazotrophicus-1.jpg
  • Gluconacetobacter diazotrophicus strain PAL5 is a nitrogen-fixing endophytic bacterium originally isolated from sugarcane and later on was found to colonize other plants such as rice, elephant grass, sweet potato, coffee, and pineapple. Currently, G. diazotrophicus has been considered a plant growth-promoting bacterium due to its characteristics of biological nitrogen fixation, phytohormone secretion, solubilization of mineral nutrients and antagonism to phytopathogens [1][2].
  • Common Name: NA
  • NCBI Taxonomy

Various Culture Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
rho[3] Rho termination factor
  • LGI medium and LGI medium
NM_003134
  • F:GCAACTCGGAACTCATCCTC
  • R:GGACCCACATCTTCGACAGT
132 58 SYBR
23S rRNA[3] Ribosomal RNA subunit 23S
  • LGI medium and LGI medium
NM_003135
  • F:GTGAGACAGTTCGGTCCCTATC
  • R:CGATTATCCCGTCCAGACTTAG
150 58 SYBR
rpoD[3] RNA polymerase Sigma factor RpoD
  • LGI medium and LGI medium
NM_003136
  • F:ACAACGACACCACTCTGCTG
  • R:CTCCGACGACATCTGATCCT
131 58 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Jean L. Simões-Araújo
  • Email: jean@cnpab.embrapa.br
  • Institute: Laboratório de Genética e Bioquímica, Embrapa Agrobiologia, Seropédica, RJ, Brazil

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. Péricles S. Galisa a,d,e, Helder A.P. da Silva b,e, Aline V.M. Macedo c, Verônica M. Reis d, Márcia S. Vidal e, José I. Baldani e, Jean L. Simões-Araújo. Identification and validation of reference genes to study the gene expression in Gluconacetobacter diazotrophicus grown in different carbon sources using RT-qPCR. J Microbiol Methods. 2012 Oct;91(1):1-7. doi:10.1016/j.mimet.2012.07.005. Epub 2012 Jul 16. PubMed PMID: 22814372.
  2. Stevenson DM, Weimer PJ. Expression of 17 genes in Clostridium thermocellum ATCC 27405 during fermentation of cellulose or cellobiose in continuous culture. Appl Environ Microbiol. 2005 Aug;71(8):4672-8. PubMed PMID: 16085862; PubMed Central PMCID: PMC1183361.
  3. 3.0 3.1 3.2 Galisa, Péricles S., et al. "Identification and validation of reference genes to study the gene expression in Gluconacetobacter diazotrophicus grown in different carbon sources using RT-qPCR." Journal of microbiological methods 91.1 (2012): 1-7.

Categories