Difference between revisions of "Glycine max"

From ICG
Jump to navigation Jump to search
 
(75 intermediate revisions by 9 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
−
[[File:Soybean_1.png|right|272px|]]
+
[[File:Glycine max.png|right|200px|link=Glycine max]]
−
* Soybean is an economically important crop worldwide, which provides important source of vegetable oil and proteins. It is the world's major agricultural crop with multiple uses including as human and animal food, biofuel, feedstock, industrial products, and cosmetics.
+
* '''''Glycine max''''' is a species of legume native to East Asia. It is the world's major economically important agricultural crop widely grown for its edible bean. It also provides important source of vegetable oil and proteins and has numerous uses such as biofuel, feedstock, industrial products, and cosmetics. The main countries growing soybeans are the United States, Brazil and Argentina<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Soybean'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3847 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
=='''Aluminum, Cadmium, Heat Stresses'''==
+
=='''''Heavy Metals & Heat Treatments'''''==
  
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 12: Line 14:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 22:
 
|align="center"| Tubulin alpha-4  
 
|align="center"| Tubulin alpha-4  
 
|
 
|
−
*Al stress in  root tips
+
* Roots under Al stress
−
* heat stress in roots and leaves
+
* Roots and leaves under heat stress  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003555953.3 '''LOC100781185''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003555953.3 '''LOC100781185''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 31: Line 33:
 
|-
 
|-
 
|align="center"| Fbox<ref name="ref1"/>
 
|align="center"| Fbox<ref name="ref1"/>
−
|align="center"| Glycine max F-box protein SKIP16-like  
+
|align="center"| F-box protein SKIP16-like  
 
|
 
|
−
*Cd stress in roots and leaves
+
* Roots and leaves under Cd stress  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001254106.2 '''LOC100809876''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001254106.2 '''LOC100809876''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 47:
 
|align="center"| Hypothetical protein  
 
|align="center"| Hypothetical protein  
 
|
 
|
−
* Cd stress in roots and leaves
+
* Roots and leaves under Cd stress
−
* heat stress in roots and leaves
+
* Roots and leaves under heat stress  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003528209.3 '''LOC100789577''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003528209.3 '''LOC100789577''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 55: Line 57:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
−
|align="center"| 60S<ref name="ref1"/>
+
|align="center"| 60SRP<ref name="ref1"/>
 
|align="center"| 60S ribosome protein  
 
|align="center"| 60S ribosome protein  
 
|
 
|
−
* Cd stress for roots and leaves
+
* Roots and leaves under Cd stress  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003551021.3 '''LOC100778077''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003551021.3 '''LOC100778077''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 68: Line 70:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 74: Line 76:
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
* '''Comparative ΔCt method''' && [https://www.ncbi.nlm.nih.gov/pubmed/17026756 '''Related Reference''']
 
* '''Comparative ΔCt method''' && [https://www.ncbi.nlm.nih.gov/pubmed/17026756 '''Related Reference''']
−
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
 
*  '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference''']
 
*  '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference''']
 +
 
===Contact===
 
===Contact===
 
*'''Name''': Yan Li
 
*'''Name''': Yan Li
 
*'''Email''': yanli1@njau.edu.cn
 
*'''Email''': yanli1@njau.edu.cn
 
*'''Institution''': National Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Key Laboratory for Biology and Genetic Improvement of Soybean (General, Ministry of Agriculture), Jiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing Agricultural University, Nanjing, Jiangsu, China
 
*'''Institution''': National Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Key Laboratory for Biology and Genetic Improvement of Soybean (General, Ministry of Agriculture), Jiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing Agricultural University, Nanjing, Jiangsu, China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=11707883890029736734&as_sdt=2005&sciodt=0,5&hl=en '''1'''] (Based on Google Scholar [2017-09-01])
  
−
=='''Diverse Biotic Stresses'''==
+
=='''''Biotic Stresses'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 90: Line 95:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 157: Line 162:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 164: Line 169:
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 +
 
===Contact===
 
===Contact===
 
*'''Name''': Raman Bansal
 
*'''Name''': Raman Bansal
 
*'''Email''': bansal.67@osu.edu
 
*'''Email''': bansal.67@osu.edu
 
*'''Institution''': Department of Entomology, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, OH, 44691, United States of America
 
*'''Institution''': Department of Entomology, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, OH, 44691, United States of America
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=11290884871876745927&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
  
−
=='''Various Abiotic Stress Conditions'''==
+
=='''''Different Tissues & Abiotic Stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 177: Line 185:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 185: Line 193:
 
|align="center"| F-box protein family
 
|align="center"| F-box protein family
 
|
 
|
−
*root and shoot tissues of soybean seedlings with dehydration treatment
+
*Root and shoot tissues of soybean seedlings with dehydration treatment
−
*root and shoot tissues of soybean seedlings under salt, ABA and cold stress
+
*Root and shoot tissues of soybean seedlings under salt, ABA and cold stress
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&search_term=Glyma12g05510.1 '''Glyma12g05510''']  
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&search_term=Glyma12g05510.1 '''Glyma12g05510''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 195: Line 203:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
−
|align="center"| ABC<ref name="ref3"/>
+
|align="center"| ABCT<ref name="ref3"/>
 
|align="center"| ATP-binding cassette transporter
 
|align="center"| ATP-binding cassette transporter
 
|
 
|
−
*root and shoot tissues of soybean seedlings with dehydration treatment
+
*Root and shoot tissues of soybean seedlings with dehydration treatment
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&version=Glyma%201.1&search_term=Glyma12g02310 '''Glyma12g02310''']  
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&version=Glyma%201.1&search_term=Glyma12g02310 '''Glyma12g02310''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 207: Line 215:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
−
|align="center"| 60s<ref name="ref3"/>
+
|align="center"| 60SRP<ref name="ref3"/>
 
|align="center"| 60s Ribosomal protein L30
 
|align="center"| 60s Ribosomal protein L30
 
|
 
|
−
*root and shoot tissues of soybean seedlings with dehydration treatment
+
*Root and shoot tissues of soybean seedlings with dehydration treatment
−
*root and shoot tissues of soybean seedlings under cold & ABA  stress
+
*Root and shoot tissues of soybean seedlings under cold & ABA  stress
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&search_term=Glyma17g05270 '''Glyma17g05270''']  
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&search_term=Glyma17g05270 '''Glyma17g05270''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 223: Line 231:
 
|align="center"| Eukaryotic elongation factor 1 beta
 
|align="center"| Eukaryotic elongation factor 1 beta
 
|
 
|
−
*root and shoot tissues of soybean seedlings under salt  & ABA stress
+
*Root and shoot tissues of soybean seedlings under salt  & ABA stress
 
|align="center"| [https://soybase.org/sbt/search/search_results.php?category=FeatureName&version=Glyma%201.1&search_term=Glyma02g44460 '''Glyma02g44460''']  
 
|align="center"| [https://soybase.org/sbt/search/search_results.php?category=FeatureName&version=Glyma%201.1&search_term=Glyma02g44460 '''Glyma02g44460''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 235: Line 243:
 
|align="center"| Insulin-degrading enzyme
 
|align="center"| Insulin-degrading enzyme
 
|
 
|
−
*root and shoot tissues of soybean seedlings under salt stress
+
*Root and shoot tissues of soybean seedlings under salt stress
−
*root and shoot tissues of soybean seedlings under cold stress
+
*Root and shoot tissues of soybean seedlings under cold stress
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/AW310136 '''AW310136''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/AW310136 '''AW310136''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 248: Line 256:
 
|align="center"| Actin
 
|align="center"| Actin
 
|
 
|
−
*root and shoot tissues of soybean seedlings under cold stress
+
*Root and shoot tissues of soybean seedlings under cold stress
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&search_term=Glyma19g32990 '''Glyma19g32990''']  
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&search_term=Glyma19g32990 '''Glyma19g32990''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 258: Line 266:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 268: Line 276:
 
*'''Email''': nguyenhenry@missouri.edu
 
*'''Email''': nguyenhenry@missouri.edu
 
*'''Institution''': National Center for Soybean Biotechnology and Division of Plant Sciences,University of Missouri, Columbia, Missouri, United States of America
 
*'''Institution''': National Center for Soybean Biotechnology and Division of Plant Sciences,University of Missouri, Columbia, Missouri, United States of America
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=7394442497640494154&as_sdt=2005&sciodt=0,5&hl=en '''83'''] (Based on Google Scholar [2017-09-01])
  
−
=='''Hypoxic Conditions'''==
+
=='''''Hypoxic Condition'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 277: Line 287:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
 
! Detection
 
! Detection
 
|-
 
|-
−
|align="center"| ELF1B <ref name="ref4"/>
+
|align="center"| ELF1B<ref name="ref4"/>
 
|align="center"| Elongation factor 1-beta
 
|align="center"| Elongation factor 1-beta
 
|
 
|
−
*flooding stress
+
*Flooding stress
 
|align="center"| [https://soybase.org/sbt/search/search_results.php?category=FeatureName&version=Glyma%201.1&search_term=Glyma02g44460 '''Glyma02g44460''']  
 
|align="center"| [https://soybase.org/sbt/search/search_results.php?category=FeatureName&version=Glyma%201.1&search_term=Glyma02g44460 '''Glyma02g44460''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 294: Line 304:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
−
|align="center"| ACTB <ref name="ref4"/>
+
|align="center"| ACTB<ref name="ref4"/>
−
|align="center"| actin-11
+
|align="center"| Actin-11
 
|
 
|
−
*flooding stress
+
*Flooding stress
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&search_term=Glyma15g05570 '''Glyma15g05570''']  
 
|align="center"| [https://www.soybase.org/sbt/search/search_results.php?category=FeatureName&search_term=Glyma15g05570 '''Glyma15g05570''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 307: Line 317:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 317: Line 327:
 
*'''Email''': alexandre.nepomuceno@embrapa.br
 
*'''Email''': alexandre.nepomuceno@embrapa.br
 
*'''Institution''': Laboratório de Biotecnologia Vegetal, Embrapa Soja, Londrina, PR, Brasil
 
*'''Institution''': Laboratório de Biotecnologia Vegetal, Embrapa Soja, Londrina, PR, Brasil
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=9946429395020319479&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
 +
 +
==''''' Abiotic or Biotic Stress'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| miR1520d<ref name="ref5"/>
 +
|align="center"| miR1520d
 +
|
 +
* Different soybean tissues and genotypes
 +
* Abiotic or biotic stress treatments
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NR_048594.1 '''NR_048594''']
 +
|nowrap style="font-size:9pt"|
 +
* F:ATCAGAACATGACACGTGACAA-3
 +
* R:GTGCAGGGTCCGAGGT-3
 +
|align="center"| 70
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| miR156b<ref name="ref5"/>
 +
|align="center"| miR156b
 +
|
 +
* Different soybean tissues and genotypes
 +
* Abiotic or biotic stress treatments
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NR_126594.1 '''NR_126594''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TGACAGAAGAGAGAGAGCACA-3
 +
* R:GTGCAGGGTCCGAGGT-3
 +
|align="center"| 72
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|}
 +
 +
===Molecular Types===
 +
* miRNA
 +
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Rogério Margis
 +
*'''Email''': rogerio.margis@ufrgs.br
 +
*'''Institution''': Centre of Biotechnology, Laboratory of Genomes and Plant Population, Building 43431, Federal University of Rio Grande do Sul–UFRGS, P.O. Box 15005, CEP 91501-970, Porto Alegre, RS, Brazil
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=14367671962286600074&as_sdt=2005&sciodt=0,5&hl=en '''83'''] (Based on Google Scholar [2017-09-01])
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
Line 333: Line 399:
 
<ref name="ref4">
 
<ref name="ref4">
 
Nakayama T J, Rodrigues F A, Neumaier N, et al. Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions[J]. Genet Mol Res, 2014, 13: 860-871.
 
Nakayama T J, Rodrigues F A, Neumaier N, et al. Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions[J]. Genet Mol Res, 2014, 13: 860-871.
 +
</ref>
 +
<ref name="ref5">
 +
Kulcheski, Franceli Rodrigues, et al. The use of microRNAs as reference genes for quantitative polymerase chain reaction in soybean. Analytical biochemistry 406.2 (2010): 185-192.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Plants]]
 +
[[Category:mRNA]][[Category:Non-coding RNA]]
 +
[[Category:SYBR]]
 +
[[Category:60SRP]] [[Category:RPL]] [[Category:ABCT]] [[Category:ABCT]] [[Category:ACT]] [[Category:Cyclophilin]] [[Category:EF1α]] [[Category:F-box]] [[Category:F-box]] [[Category:F-box]] [[Category:IDE]] [[Category:Tubulin]] [[Category:Tubulin]] [[Category:Tubulin]]
 +
[[Category:Salinity Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Dehydration Treatment]]  [[Category:Biotic Stress]]  [[Category:Hormone Treatment]]  [[Category:Hypoxic Treatment]]  [[Category:Cold Treatment]]  [[Category:Heavy Metals Treatments]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]
 +
[[Category:SKIP]]

Latest revision as of 07:17, 1 September 2017

Description

Glycine max.png
  • Glycine max is a species of legume native to East Asia. It is the world's major economically important agricultural crop widely grown for its edible bean. It also provides important source of vegetable oil and proteins and has numerous uses such as biofuel, feedstock, industrial products, and cosmetics. The main countries growing soybeans are the United States, Brazil and Argentina[1][2].
  • Common Name: Soybean
  • NCBI Taxonomy

Heavy Metals & Heat Treatments

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
TUA4[1] Tubulin alpha-4
  • Roots under Al stress
  • Roots and leaves under heat stress
 LOC100781185
  • F:CATACCCTAGAATCCATTTC-3
  • R:TGTACTTTCCGTGACGAG-3
 159 60 SYBR
Fbox[1] F-box protein SKIP16-like
  • Roots and leaves under Cd stress
 LOC100809876
  • F:AGATAGGGAAATTGTGCAGGT-3
  • R:CTAATGGCAATTGCAGCTCTC-3
 93 60 SYBR
UKN2[1] Hypothetical protein
  • Roots and leaves under Cd stress
  • Roots and leaves under heat stress
 LOC100789577
  • F:TGTGCTCTGTGAAGAGATTG-3
  • R:TCATAATCTGTGTGCAGTTC-3
 156 60 SYBR
60SRP[1] 60S ribosome protein
  • Roots and leaves under Cd stress
 LOC100778077
  • F:AAAGTGGACCAAGGCATATCGTCG-3
  • R:TCAGGACATTCTCCGCAAGATTCC-3
 125 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yan Li
  • Email: yanli1@njau.edu.cn
  • Institution: National Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Key Laboratory for Biology and Genetic Improvement of Soybean (General, Ministry of Agriculture), Jiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing Agricultural University, Nanjing, Jiangsu, China

Citation Statistics

Cited by 1 (Based on Google Scholar [2017-09-01])

Biotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
ABCT[2] ATP-binding cassette transporter
  • BPMV and SBA stress
 Glyma.12g020500
  • F:CTTTGCTTTTATTCCGAATGG
  • R:GCCTGCTTCAGATAAAATAGAT
 166 79.5 SYBR
FBOX[2] F-box only protein
  • BPMV and SBA stress
 Glyma.12g051100
  • F:GAAAGCAGAAAGATGGGGTTGG
  • R:CACACACGCCACTCTCGCAA
 99 80 SYBR
TUA4[2] Tubulin alpha-4
  • PMD stress
  • TSSM stress
 Glyma.20g136000
  • F:TGTGTACCAGTACCGATGTGGT
  • R:GCACTCCCGTGCCCGTAA
 150 79.5 SYBR
CYP[2] Cyclophilin
  • PMD stress
 Glyma.12g024700
  • F:GTCGAGGGGATGGACGTC
  • R:CGACACATTCAGAGCCACCGA
 158 85 SYBR
TUB4[2] Tubulin beta-4
  • TSSM stress
 Glyma.19g127700
  • F:TTCTCTGCACTCTTCATCAAGCTC
  • R:CACACCACTTCCCAGAACTTG
 117 83 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Raman Bansal
  • Email: bansal.67@osu.edu
  • Institution: Department of Entomology, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, OH, 44691, United States of America

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Fbox[3] F-box protein family
  • Root and shoot tissues of soybean seedlings with dehydration treatment
  • Root and shoot tissues of soybean seedlings under salt, ABA and cold stress
 Glyma12g05510
  • F:GATCAGCAATTATGCACAACG
  • R:CTAATGGCAATTGCAGCTCTC
 118 60 SYBR
ABCT[3] ATP-binding cassette transporter
  • Root and shoot tissues of soybean seedlings with dehydration treatment
 Glyma12g02310
  • F:GAGCTATGAATTGCCTGATGG
  • R:CCGCCACCATTCAGATTATGT
 106 60 SYBR
60SRP[3] 60s Ribosomal protein L30
  • Root and shoot tissues of soybean seedlings with dehydration treatment
  • Root and shoot tissues of soybean seedlings under cold & ABA stress
 Glyma17g05270
  • F:AAAGTGGACCAAGGCATATCGTCG
  • R:TCAGGACATTCTCCGCAAGATTCC
 125 60 SYBR
ELF1b[3] Eukaryotic elongation factor 1 beta
  • Root and shoot tissues of soybean seedlings under salt & ABA stress
 Glyma02g44460
  • F:GTTGAAAAGCCAGGGGACA
  • R:TCTTACCCCTTGAGCGTGG
 118 60 SYBR
IDE[3] Insulin-degrading enzyme
  • Root and shoot tissues of soybean seedlings under salt stress
  • Root and shoot tissues of soybean seedlings under cold stress
 AW310136
  • F:ATGAATGACGGTTCCCATGTA
  • R:GGCATTAAGGCAGCTCACTCT
 131 60 SYBR
Act27[3] Actin
  • Root and shoot tissues of soybean seedlings under cold stress
 Glyma19g32990
  • F:CTTCCCTCAGCACCTTCCAA
  • R:GGTCCAGCTTTCACACTCCAT
 119 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Henry T. Nguyen
  • Email: nguyenhenry@missouri.edu
  • Institution: National Center for Soybean Biotechnology and Division of Plant Sciences,University of Missouri, Columbia, Missouri, United States of America

Citation Statistics

Cited by 83 (Based on Google Scholar [2017-09-01])

Hypoxic Condition

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
ELF1B[4] Elongation factor 1-beta
  • Flooding stress
 Glyma02g44460
  • F:GTTGAAAAGCCAGGGGACA-3
  • R:TCTTACCCCTTGAGCGTGG-3
 118 60 SYBR
ACTB[4] Actin-11
  • Flooding stress
 Glyma15g05570
  • F:GAGCTATGAATTGCCTGATGG-3
  • R:CGTTTCATGAATTCCAGTAGC-3
 118 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: A.L. Nepomuceno
  • Email: alexandre.nepomuceno@embrapa.br
  • Institution: Laboratório de Biotecnologia Vegetal, Embrapa Soja, Londrina, PR, Brasil

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Abiotic or Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
miR1520d[5] miR1520d
  • Different soybean tissues and genotypes
  • Abiotic or biotic stress treatments
 NR_048594
  • F:ATCAGAACATGACACGTGACAA-3
  • R:GTGCAGGGTCCGAGGT-3
 70 60 SYBR
miR156b[5] miR156b
  • Different soybean tissues and genotypes
  • Abiotic or biotic stress treatments
 NR_126594
  • F:TGACAGAAGAGAGAGAGCACA-3
  • R:GTGCAGGGTCCGAGGT-3
 72 60 SYBR

Molecular Types

  • miRNA

Evaluation Methods

Contact

  • Name: Rogério Margis
  • Email: rogerio.margis@ufrgs.br
  • Institution: Centre of Biotechnology, Laboratory of Genomes and Plant Population, Building 43431, Federal University of Rio Grande do Sul–UFRGS, P.O. Box 15005, CEP 91501-970, Porto Alegre, RS, Brazil

Citation Statistics

Cited by 83 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Gao M, Liu Y, Ma X, et al. Evaluation of Reference Genes for Normalization of Gene Expression Using Quantitative RT-PCR under Aluminum, Cadmium, and Heat Stresses in Soybean[J]. PloS one, 2017, 12(1): e0168965.
  2. ↑ 2.0 2.1 2.2 2.3 2.4 2.5 Bansal R, Mittapelly P, Cassone B J, et al. Recommended reference genes for quantitative PCR analysis in soybean have variable stabilities during diverse biotic stresses[J]. PloS one, 2015, 10(8): e0134890.
  3. ↑ 3.0 3.1 3.2 3.3 3.4 3.5 Le D T, Aldrich D L, Valliyodan B, et al. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions[J]. PLoS One, 2012, 7(9): e46487.
  4. ↑ 4.0 4.1 Nakayama T J, Rodrigues F A, Neumaier N, et al. Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions[J]. Genet Mol Res, 2014, 13: 860-871.
  5. ↑ 5.0 5.1 Kulcheski, Franceli Rodrigues, et al. The use of microRNAs as reference genes for quantitative polymerase chain reaction in soybean. Analytical biochemistry 406.2 (2010): 185-192.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Glycine_max&oldid=8751"