Difference between revisions of "Glycine max"

From ICG
Jump to navigation Jump to search
 
(35 intermediate revisions by 6 users not shown)
Line 7: Line 7:
 
=='''''Heavy Metals & Heat Treatments'''''==
 
=='''''Heavy Metals & Heat Treatments'''''==
  
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 22: Line 22:
 
|align="center"| Tubulin alpha-4  
 
|align="center"| Tubulin alpha-4  
 
|
 
|
−
*Al stress in  root tips
+
* Roots under Al stress
−
* Heat stress in roots and leaves
+
* Roots and leaves under heat stress
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003555953.3 '''LOC100781185''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003555953.3 '''LOC100781185''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 33:
 
|-
 
|-
 
|align="center"| Fbox<ref name="ref1"/>
 
|align="center"| Fbox<ref name="ref1"/>
−
|align="center"| Glycine max F-box protein SKIP16-like  
+
|align="center"| F-box protein SKIP16-like  
 
|
 
|
−
*Cd stress in roots and leaves
+
* Roots and leaves under Cd stress  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001254106.2 '''LOC100809876''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001254106.2 '''LOC100809876''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 47: Line 47:
 
|align="center"| Hypothetical protein  
 
|align="center"| Hypothetical protein  
 
|
 
|
−
* Cd stress in roots and leaves
+
* Roots and leaves under Cd stress
−
* Heat stress in roots and leaves
+
* Roots and leaves under heat stress
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003528209.3 '''LOC100789577''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003528209.3 '''LOC100789577''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 60: Line 60:
 
|align="center"| 60S ribosome protein  
 
|align="center"| 60S ribosome protein  
 
|
 
|
−
* Cd stress in roots and leaves
+
* Roots and leaves under Cd stress  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003551021.3 '''LOC100778077''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003551021.3 '''LOC100778077''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 76: Line 76:
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
* '''Comparative ΔCt method''' && [https://www.ncbi.nlm.nih.gov/pubmed/17026756 '''Related Reference''']
 
* '''Comparative ΔCt method''' && [https://www.ncbi.nlm.nih.gov/pubmed/17026756 '''Related Reference''']
−
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
 
*  '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference''']
 
*  '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference''']
 +
 
===Contact===
 
===Contact===
 
*'''Name''': Yan Li
 
*'''Name''': Yan Li
Line 84: Line 85:
 
*'''Institution''': National Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Key Laboratory for Biology and Genetic Improvement of Soybean (General, Ministry of Agriculture), Jiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing Agricultural University, Nanjing, Jiangsu, China
 
*'''Institution''': National Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Key Laboratory for Biology and Genetic Improvement of Soybean (General, Ministry of Agriculture), Jiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing Agricultural University, Nanjing, Jiangsu, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''1''' (Based on Google Scholar [2017-06-29])
+
Cited by [https://scholar.google.com/scholar?cites=11707883890029736734&as_sdt=2005&sciodt=0,5&hl=en '''1'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Biotic Stresses'''''==
 
=='''''Biotic Stresses'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 168: Line 169:
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 +
 
===Contact===
 
===Contact===
 
*'''Name''': Raman Bansal
 
*'''Name''': Raman Bansal
Line 173: Line 175:
 
*'''Institution''': Department of Entomology, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, OH, 44691, United States of America
 
*'''Institution''': Department of Entomology, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, OH, 44691, United States of America
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''9''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=11290884871876745927&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Different Tissues & Abiotic Stress'''''==
 
=='''''Different Tissues & Abiotic Stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 275: Line 277:
 
*'''Institution''': National Center for Soybean Biotechnology and Division of Plant Sciences,University of Missouri, Columbia, Missouri, United States of America
 
*'''Institution''': National Center for Soybean Biotechnology and Division of Plant Sciences,University of Missouri, Columbia, Missouri, United States of America
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''85''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=7394442497640494154&as_sdt=2005&sciodt=0,5&hl=en '''83'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Hypoxic Condition'''''==
 
=='''''Hypoxic Condition'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 326: Line 328:
 
*'''Institution''': Laboratório de Biotecnologia Vegetal, Embrapa Soja, Londrina, PR, Brasil
 
*'''Institution''': Laboratório de Biotecnologia Vegetal, Embrapa Soja, Londrina, PR, Brasil
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''10''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=9946429395020319479&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
 +
 
 +
==''''' Abiotic or Biotic Stress'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| miR1520d<ref name="ref5"/>
 +
|align="center"| miR1520d
 +
|
 +
* Different soybean tissues and genotypes
 +
* Abiotic or biotic stress treatments
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NR_048594.1 '''NR_048594''']
 +
|nowrap style="font-size:9pt"|
 +
* F:ATCAGAACATGACACGTGACAA-3
 +
* R:GTGCAGGGTCCGAGGT-3
 +
|align="center"| 70
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| miR156b<ref name="ref5"/>
 +
|align="center"| miR156b
 +
|
 +
* Different soybean tissues and genotypes
 +
* Abiotic or biotic stress treatments
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NR_126594.1 '''NR_126594''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TGACAGAAGAGAGAGAGCACA-3
 +
* R:GTGCAGGGTCCGAGGT-3
 +
|align="center"| 72
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|}
 +
 
 +
===Molecular Types===
 +
* miRNA
 +
 
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Rogério Margis
 +
*'''Email''': rogerio.margis@ufrgs.br
 +
*'''Institution''': Centre of Biotechnology, Laboratory of Genomes and Plant Population, Building 43431, Federal University of Rio Grande do Sul–UFRGS, P.O. Box 15005, CEP 91501-970, Porto Alegre, RS, Brazil
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=14367671962286600074&as_sdt=2005&sciodt=0,5&hl=en '''83'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 344: Line 399:
 
<ref name="ref4">
 
<ref name="ref4">
 
Nakayama T J, Rodrigues F A, Neumaier N, et al. Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions[J]. Genet Mol Res, 2014, 13: 860-871.
 
Nakayama T J, Rodrigues F A, Neumaier N, et al. Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions[J]. Genet Mol Res, 2014, 13: 860-871.
 +
</ref>
 +
<ref name="ref5">
 +
Kulcheski, Franceli Rodrigues, et al. The use of microRNAs as reference genes for quantitative polymerase chain reaction in soybean. Analytical biochemistry 406.2 (2010): 185-192.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
−
[[Category:mRNA]]
+
[[Category:mRNA]][[Category:Non-coding RNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
−
[[Category:60SRP]] [[Category:60SRP]] [[Category:ABCT]] [[Category:ABCT]] [[Category:ACT]] [[Category:ACT]] [[Category:CYC]] [[Category:eIF]] [[Category:eIF]] [[Category:F-box]] [[Category:F-box]] [[Category:F-box]] [[Category:IDE]] [[Category:Tubulin]] [[Category:Tubulin]] [[Category:Tubulin]] [[Category:UKN1]]
+
[[Category:60SRP]] [[Category:RPL]] [[Category:ABCT]] [[Category:ABCT]] [[Category:ACT]] [[Category:Cyclophilin]] [[Category:EF1α]] [[Category:F-box]] [[Category:F-box]] [[Category:F-box]] [[Category:IDE]] [[Category:Tubulin]] [[Category:Tubulin]] [[Category:Tubulin]]
 
[[Category:Salinity Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Dehydration Treatment]]  [[Category:Biotic Stress]]  [[Category:Hormone Treatment]]  [[Category:Hypoxic Treatment]]  [[Category:Cold Treatment]]  [[Category:Heavy Metals Treatments]]
 
[[Category:Salinity Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Dehydration Treatment]]  [[Category:Biotic Stress]]  [[Category:Hormone Treatment]]  [[Category:Hypoxic Treatment]]  [[Category:Cold Treatment]]  [[Category:Heavy Metals Treatments]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]
 +
[[Category:SKIP]]

Latest revision as of 07:17, 1 September 2017

Description

Glycine max.png
  • Glycine max is a species of legume native to East Asia. It is the world's major economically important agricultural crop widely grown for its edible bean. It also provides important source of vegetable oil and proteins and has numerous uses such as biofuel, feedstock, industrial products, and cosmetics. The main countries growing soybeans are the United States, Brazil and Argentina[1][2].
  • Common Name: Soybean
  • NCBI Taxonomy

Heavy Metals & Heat Treatments

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
TUA4[1] Tubulin alpha-4
  • Roots under Al stress
  • Roots and leaves under heat stress
 LOC100781185
  • F:CATACCCTAGAATCCATTTC-3
  • R:TGTACTTTCCGTGACGAG-3
 159 60 SYBR
Fbox[1] F-box protein SKIP16-like
  • Roots and leaves under Cd stress
 LOC100809876
  • F:AGATAGGGAAATTGTGCAGGT-3
  • R:CTAATGGCAATTGCAGCTCTC-3
 93 60 SYBR
UKN2[1] Hypothetical protein
  • Roots and leaves under Cd stress
  • Roots and leaves under heat stress
 LOC100789577
  • F:TGTGCTCTGTGAAGAGATTG-3
  • R:TCATAATCTGTGTGCAGTTC-3
 156 60 SYBR
60SRP[1] 60S ribosome protein
  • Roots and leaves under Cd stress
 LOC100778077
  • F:AAAGTGGACCAAGGCATATCGTCG-3
  • R:TCAGGACATTCTCCGCAAGATTCC-3
 125 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yan Li
  • Email: yanli1@njau.edu.cn
  • Institution: National Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Key Laboratory for Biology and Genetic Improvement of Soybean (General, Ministry of Agriculture), Jiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing Agricultural University, Nanjing, Jiangsu, China

Citation Statistics

Cited by 1 (Based on Google Scholar [2017-09-01])

Biotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
ABCT[2] ATP-binding cassette transporter
  • BPMV and SBA stress
 Glyma.12g020500
  • F:CTTTGCTTTTATTCCGAATGG
  • R:GCCTGCTTCAGATAAAATAGAT
 166 79.5 SYBR
FBOX[2] F-box only protein
  • BPMV and SBA stress
 Glyma.12g051100
  • F:GAAAGCAGAAAGATGGGGTTGG
  • R:CACACACGCCACTCTCGCAA
 99 80 SYBR
TUA4[2] Tubulin alpha-4
  • PMD stress
  • TSSM stress
 Glyma.20g136000
  • F:TGTGTACCAGTACCGATGTGGT
  • R:GCACTCCCGTGCCCGTAA
 150 79.5 SYBR
CYP[2] Cyclophilin
  • PMD stress
 Glyma.12g024700
  • F:GTCGAGGGGATGGACGTC
  • R:CGACACATTCAGAGCCACCGA
 158 85 SYBR
TUB4[2] Tubulin beta-4
  • TSSM stress
 Glyma.19g127700
  • F:TTCTCTGCACTCTTCATCAAGCTC
  • R:CACACCACTTCCCAGAACTTG
 117 83 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Raman Bansal
  • Email: bansal.67@osu.edu
  • Institution: Department of Entomology, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, OH, 44691, United States of America

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Fbox[3] F-box protein family
  • Root and shoot tissues of soybean seedlings with dehydration treatment
  • Root and shoot tissues of soybean seedlings under salt, ABA and cold stress
 Glyma12g05510
  • F:GATCAGCAATTATGCACAACG
  • R:CTAATGGCAATTGCAGCTCTC
 118 60 SYBR
ABCT[3] ATP-binding cassette transporter
  • Root and shoot tissues of soybean seedlings with dehydration treatment
 Glyma12g02310
  • F:GAGCTATGAATTGCCTGATGG
  • R:CCGCCACCATTCAGATTATGT
 106 60 SYBR
60SRP[3] 60s Ribosomal protein L30
  • Root and shoot tissues of soybean seedlings with dehydration treatment
  • Root and shoot tissues of soybean seedlings under cold & ABA stress
 Glyma17g05270
  • F:AAAGTGGACCAAGGCATATCGTCG
  • R:TCAGGACATTCTCCGCAAGATTCC
 125 60 SYBR
ELF1b[3] Eukaryotic elongation factor 1 beta
  • Root and shoot tissues of soybean seedlings under salt & ABA stress
 Glyma02g44460
  • F:GTTGAAAAGCCAGGGGACA
  • R:TCTTACCCCTTGAGCGTGG
 118 60 SYBR
IDE[3] Insulin-degrading enzyme
  • Root and shoot tissues of soybean seedlings under salt stress
  • Root and shoot tissues of soybean seedlings under cold stress
 AW310136
  • F:ATGAATGACGGTTCCCATGTA
  • R:GGCATTAAGGCAGCTCACTCT
 131 60 SYBR
Act27[3] Actin
  • Root and shoot tissues of soybean seedlings under cold stress
 Glyma19g32990
  • F:CTTCCCTCAGCACCTTCCAA
  • R:GGTCCAGCTTTCACACTCCAT
 119 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Henry T. Nguyen
  • Email: nguyenhenry@missouri.edu
  • Institution: National Center for Soybean Biotechnology and Division of Plant Sciences,University of Missouri, Columbia, Missouri, United States of America

Citation Statistics

Cited by 83 (Based on Google Scholar [2017-09-01])

Hypoxic Condition

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
ELF1B[4] Elongation factor 1-beta
  • Flooding stress
 Glyma02g44460
  • F:GTTGAAAAGCCAGGGGACA-3
  • R:TCTTACCCCTTGAGCGTGG-3
 118 60 SYBR
ACTB[4] Actin-11
  • Flooding stress
 Glyma15g05570
  • F:GAGCTATGAATTGCCTGATGG-3
  • R:CGTTTCATGAATTCCAGTAGC-3
 118 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: A.L. Nepomuceno
  • Email: alexandre.nepomuceno@embrapa.br
  • Institution: Laboratório de Biotecnologia Vegetal, Embrapa Soja, Londrina, PR, Brasil

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Abiotic or Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
miR1520d[5] miR1520d
  • Different soybean tissues and genotypes
  • Abiotic or biotic stress treatments
 NR_048594
  • F:ATCAGAACATGACACGTGACAA-3
  • R:GTGCAGGGTCCGAGGT-3
 70 60 SYBR
miR156b[5] miR156b
  • Different soybean tissues and genotypes
  • Abiotic or biotic stress treatments
 NR_126594
  • F:TGACAGAAGAGAGAGAGCACA-3
  • R:GTGCAGGGTCCGAGGT-3
 72 60 SYBR

Molecular Types

  • miRNA

Evaluation Methods

Contact

  • Name: Rogério Margis
  • Email: rogerio.margis@ufrgs.br
  • Institution: Centre of Biotechnology, Laboratory of Genomes and Plant Population, Building 43431, Federal University of Rio Grande do Sul–UFRGS, P.O. Box 15005, CEP 91501-970, Porto Alegre, RS, Brazil

Citation Statistics

Cited by 83 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Gao M, Liu Y, Ma X, et al. Evaluation of Reference Genes for Normalization of Gene Expression Using Quantitative RT-PCR under Aluminum, Cadmium, and Heat Stresses in Soybean[J]. PloS one, 2017, 12(1): e0168965.
  2. ↑ 2.0 2.1 2.2 2.3 2.4 2.5 Bansal R, Mittapelly P, Cassone B J, et al. Recommended reference genes for quantitative PCR analysis in soybean have variable stabilities during diverse biotic stresses[J]. PloS one, 2015, 10(8): e0134890.
  3. ↑ 3.0 3.1 3.2 3.3 3.4 3.5 Le D T, Aldrich D L, Valliyodan B, et al. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions[J]. PLoS One, 2012, 7(9): e46487.
  4. ↑ 4.0 4.1 Nakayama T J, Rodrigues F A, Neumaier N, et al. Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions[J]. Genet Mol Res, 2014, 13: 860-871.
  5. ↑ 5.0 5.1 Kulcheski, Franceli Rodrigues, et al. The use of microRNAs as reference genes for quantitative polymerase chain reaction in soybean. Analytical biochemistry 406.2 (2010): 185-192.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Glycine_max&oldid=8751"