Difference between revisions of "Gossypium hirsutum"

From ICG
Jump to navigation Jump to search
Line 174: Line 174:
 
|align="center"| catalytic subunit of protein phosphatase 2A
 
|align="center"| catalytic subunit of protein phosphatase 2A
 
|
 
|
* distinct plants organs
+
* Distinct plants organs
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT545658 '''DT545658''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT545658 '''DT545658''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 186: Line 186:
 
|align="center"| ubiquilin  
 
|align="center"| ubiquilin  
 
|
 
|
* distinct plants organs
+
* Distinct plants organs
* flower development
+
* Flower development
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DW505546 '''DW505546''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DW505546 '''DW505546''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 199: Line 199:
 
|align="center"| actin gene family
 
|align="center"| actin gene family
 
|
 
|
*flower development
+
*Flower development
*floral verticils
+
*Floral verticils
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY305726 '''AY305726''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY305726 '''AY305726''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 212: Line 212:
 
|align="center"| F-box family protein
 
|align="center"| F-box family protein
 
|
 
|
*floral verticils
+
*Floral verticils
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DR463903 '''DR463903''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DR463903 '''DR463903''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 224: Line 224:
 
|align="center"| clathrin adaptor complexes medium subunit family protein
 
|align="center"| clathrin adaptor complexes medium subunit family protein
 
|
 
|
*fruit development
+
*Fruit development
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT571956 '''DT571956''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT571956 '''DT571956''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 236: Line 236:
 
|align="center"| polypyrimidine tract-binding protein homolog
 
|align="center"| polypyrimidine tract-binding protein homolog
 
|
 
|
*fruit development
+
*Fruit development
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT571956 '''DT571956''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT571956 '''DT571956''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|

Revision as of 02:11, 18 June 2017

Description

Gossypium hirsutum-1.jpg
  • Cotton (Gossypium hirsutum L.) is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development.
  • It is one of the most important cash crops that provide fiber to the textile industries around the world. According to the rough estimation regarding the world production of cotton, 80% comes from Brazil, China, India, Pakistan, Turkey, USA, and Uzbekistan.
  • This crop contributes a major portion to the gross national product (GNP) of many countries[1] [2] [3].

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GhUBQ7[1] ubiquitin extension protein 7
  • Leaves & roots under salt stress and drought stress
DQ116441
  • F:GAATGTGGCGCCGGGACCTTC
  • R:ACTCAATCCCCACCAGCCTTCTGG
101 60 TaqMan
GhGAPDH[1] glyceraldehyde-3-phosphate dehydroge- nase C subunit
  • Leaves & roots under salt stress and drought stress
FJ415206
  • F:TGATGCCAAGGCTGGAATTGCTT
  • R:GTGTCGGATCAAGTCGATAACACGG
106 60 TaqMan
GhEF1A8[1] translation elongation factor 1A-8
  • Leaves & roots under salt stress and drought stress
DQ174257
  • F:TGAGACAGACTGTTGCTGTTGGTG
  • R:ACCAAAGTTCACTTGCCACCCTTC
109 60 TaqMan
GhTUA10[1] alpha-tubulin 10
  • Roots under salt stress
  • Leaves & roots under drought stress
FJ594490
  • F:CACGTGAAGATCTCGCTGCCCT
  • R:ACGGTACATCCCTCAATACTCCTCC
104 60 TaqMan
GhCYP1[1] cydophilin 1
  • Roots under drought stress
GQ292530
  • F:CACCATGGCCTCAAATCCCAAGGT
  • R:CTCCGCAGTGCGAGGAGTGC
109 60 TaqMan

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Baohong Zhang
  • Email: zhangb@ecu.edu
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-06-16])

Fiber Development & Somatic Embryogenesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Histone3[2] histone 3 
  • Fiber development and somatic embryogenesis
AF024716
  • F:TCAAGACTGATTTGCGTTTCCA
  • R:GCGCAAAGGTTGGTGTCTTC
100 60 SYBR
UBQ7[2] ubiquitin extension protein 
  • Fiber development and somatic embryogenesis
DQ116441
  • F:GAAGGCATTCCACCTGACCAAC
  • R:CTTGACCTTCTTCTTCTTGTGCTTG
198 60 SYBR
Gbpolyubiquitin-1[2] fiber polyubiquitin
  • Fiber development and somatic embryogenesis
AY375335
  • F:AGCTCGGATACGATTGATAACG
  • R:GAAGACGAAGAACAAGGGGAAG
166 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: ZHANG XianLong
  • Email: xlzhang@mail.hzau.edu.cn
  • Institution: National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China

Citation Statistics

Cited by 51 (Based on Google Scholar [2017-06-16])

Different Organs & Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GhPP2A1[4] catalytic subunit of protein phosphatase 2A
  • Distinct plants organs
DT545658
  • F:GATCCTTGTGGAGGAGTGGA
  • R:GCGAAACAGTTCGACGAGAT
1301 60~61 SYBR
GhUBQ14[4] ubiquilin
  • Distinct plants organs
  • Flower development
DW505546
  • F:CAACGCTCCATCTTGTCCTT
  • R:TGATCGTCTTTCCCGTAAGC
1502 60~61 SYBR
GhACT4[4] actin gene family
  • Flower development
  • Floral verticils
AY305726
  • F:TTGCAGACCGTATGAGCAAG
  • R:ATCCTCCGATCCAGACACTG
1700 60~61 SYBR
GhFBX6[4] F-box family protein
  • Floral verticils
DR463903
  • F:TGCCTGCAGTAAATCTGTGC
  • R:GGGTGAAAGGGTTTCCAAAT
1884 60~61 SYBR
GhMZA[4] clathrin adaptor complexes medium subunit family protein
  • Fruit development
DT571956
  • F:CCGTCAGACAGATTGGAGGT
  • R:AAAGCAACAGCCTCAACGAC
1853 60~61 SYBR
GhPTB[4] polypyrimidine tract-binding protein homolog
  • Fruit development
DT571956
  • F:GGTTACCATTGAGGGTGTGG
  • R:GTGCACAAAACCAAATGCAG
1511 60~61 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Marcio Alves-Ferreira
  • Email: alvesfer@biologia.ufrj.br
  • Institution: Department of Genetics, Federal University of Rio de Janeiro-UFRJ Av Prof Rodolpho Paulo Rocco, s/n - Prédio do CCS Instituto de Biologia, 2oandar - sala A2-93, 219410-970 - Rio de Janeiro, RJ - Brasil

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Wang M, Wang Q, Zhang B. Evaluation and selection of reliable reference genes for gene expression under abiotic stress in cotton (Gossypium hirsutum L.)[J]. Gene, 2013, 530(1): 44-50.
  2. 2.0 2.1 2.2 2.3 Tu L L, Zhang X L, Liu D Q, et al. Suitable internal control genes for qRT-PCR normalization in cotton fiber development and somatic embryogenesis[J]. Chinese Science Bulletin, 2007, 52(22): 3110-3117.
  3. Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).
  4. 4.0 4.1 4.2 4.3 4.4 4.5 Artico S, Nardeli S M, Brilhante O, et al. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data[J]. BMC plant biology, 2010, 10(1): 49.