Difference between revisions of "Gossypium hirsutum"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
Line 156: | Line 156: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
Cited by '''51''' (Based on Google Scholar [2017-06-16]) | Cited by '''51''' (Based on Google Scholar [2017-06-16]) | ||
+ | |||
+ | =='''Different Organs & Developmental Stages'''== | ||
+ | |||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primer | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| GhPP2A1<ref name="ref1"/> | ||
+ | |align="center"| catalytic subunit of protein phosphatase 2A | ||
+ | | | ||
+ | * distinct plants organs | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT545658 '''DT545658'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GATCCTTGTGGAGGAGTGGA | ||
+ | * R:GCGAAACAGTTCGACGAGAT | ||
+ | |align="center"| 1301 | ||
+ | |align="center"| 60~61 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GhUBQ14<ref name="ref1"/> | ||
+ | |align="center"| | ||
+ | | | ||
+ | * distinct plants organs | ||
+ | * flower development | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DW505546 '''DW505546'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CAACGCTCCATCTTGTCCTT | ||
+ | * R:TGATCGTCTTTCCCGTAAGC | ||
+ | |align="center"| 1502 | ||
+ | |align="center"| 60~61 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GhACT4<ref name="ref1"/> | ||
+ | |align="center"| actin gene family | ||
+ | | | ||
+ | *flower development | ||
+ | *floral verticils | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY305726 '''AY305726'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TTGCAGACCGTATGAGCAAG | ||
+ | * R:ATCCTCCGATCCAGACACTG | ||
+ | |align="center"| 1700 | ||
+ | |align="center"| 60~61 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GhFBX6<ref name="ref1"/> | ||
+ | |align="center"| F-box family protein | ||
+ | | | ||
+ | *floral verticils | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DR463903 '''DR463903'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TGCCTGCAGTAAATCTGTGC | ||
+ | * R:GGGTGAAAGGGTTTCCAAAT | ||
+ | |align="center"| 1884 | ||
+ | |align="center"| 60~61 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GhMZA<ref name="ref1"/> | ||
+ | |align="center"| clathrin adaptor complexes medium subunit family protein | ||
+ | | | ||
+ | *fruit development | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT571956 '''DT571956'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CCGTCAGACAGATTGGAGGT | ||
+ | * R:AAAGCAACAGCCTCAACGAC | ||
+ | |align="center"| 1853 | ||
+ | |align="center"| 60~61 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GhPTB<ref name="ref1"/> | ||
+ | |align="center"| polypyrimidine tract-binding protein homolog | ||
+ | | | ||
+ | *fruit development | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT571956 '''DT571956'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GGTTACCATTGAGGGTGTGG | ||
+ | * R:GTGCACAAAACCAAATGCAG | ||
+ | |align="center"| 1511 | ||
+ | |align="center"| 60~61 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | ===Moleculer Type=== | ||
+ | * mRNA | ||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Marcio Alves-Ferreira | ||
+ | *'''Email''': alvesfer@biologia.ufrj.br | ||
+ | *'''Institution''': Department of Genetics, Federal University of Rio de Janeiro-UFRJ Av Prof Rodolpho Paulo Rocco, s/n - Prédio do CCS Instituto de Biologia, 2oandar - sala A2-93, 219410-970 - Rio de Janeiro, RJ - Brasil | ||
+ | =='''References'''== | ||
+ | <references> | ||
+ | <ref name="ref1"> | ||
+ | Artico S, Nardeli S M, Brilhante O, et al. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data[J]. BMC plant biology, 2010, 10(1): 49. | ||
+ | </ref> | ||
+ | </references> | ||
=='''References'''== | =='''References'''== |
Revision as of 12:20, 16 June 2017
Contents
Description
- Cotton (Gossypium hirsutum L.) is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development.
- It is one of the most important cash crops that provide fiber to the textile industries around the world. According to the rough estimation regarding the world production of cotton, 80% comes from Brazil, China, India, Pakistan, Turkey, USA, and Uzbekistan.
- This crop contributes a major portion to the gross national product (GNP) of many countries[1] [2] [3].
Abiotic Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GhUBQ7[1] | ubiquitin extension protein 7 |
|
DQ116441 |
|
101 | 60 | TaqMan |
GhGAPDH[1] | glyceraldehyde-3-phosphate dehydroge- nase C subunit |
|
FJ415206 |
|
106 | 60 | TaqMan |
GhEF1A8[1] | translation elongation factor 1A-8 |
|
DQ174257 |
|
109 | 60 | TaqMan |
GhTUA10[1] | alpha-tubulin 10 |
|
FJ594490 |
|
104 | 60 | TaqMan |
GhCYP1[1] | cydophilin 1 |
|
GQ292530 |
|
109 | 60 | TaqMan |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Baohong Zhang
- Email: zhangb@ecu.edu
- Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India
Citation Statistics
Cited by 31 (Based on Google Scholar [2017-06-16])
Fiber Development & Somatic Embryogenesis
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Histone3[2] | histone 3 |
|
AF024716 |
|
100 | 60 | SYBR |
UBQ7[2] | ubiquitin extension protein |
|
DQ116441 |
|
198 | 60 | SYBR |
Gbpolyubiquitin-1[2] | fiber polyubiquitin |
|
AY375335 |
|
166 | 60 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
Contact
- Name: ZHANG XianLong
- Email: xlzhang@mail.hzau.edu.cn
- Institution: National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China
Citation Statistics
Cited by 51 (Based on Google Scholar [2017-06-16])
Different Organs & Developmental Stages
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GhPP2A1[1] | catalytic subunit of protein phosphatase 2A |
|
DT545658 |
|
1301 | 60~61 | SYBR |
GhUBQ14[1] |
|
DW505546 |
|
1502 | 60~61 | SYBR | |
GhACT4[1] | actin gene family |
|
AY305726 |
|
1700 | 60~61 | SYBR |
GhFBX6[1] | F-box family protein |
|
DR463903 |
|
1884 | 60~61 | SYBR |
GhMZA[1] | clathrin adaptor complexes medium subunit family protein |
|
DT571956 |
|
1853 | 60~61 | SYBR |
GhPTB[1] | polypyrimidine tract-binding protein homolog |
|
DT571956 |
|
1511 | 60~61 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
Contact
- Name: Marcio Alves-Ferreira
- Email: alvesfer@biologia.ufrj.br
- Institution: Department of Genetics, Federal University of Rio de Janeiro-UFRJ Av Prof Rodolpho Paulo Rocco, s/n - Prédio do CCS Instituto de Biologia, 2oandar - sala A2-93, 219410-970 - Rio de Janeiro, RJ - Brasil
References
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Artico S, Nardeli S M, Brilhante O, et al. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data[J]. BMC plant biology, 2010, 10(1): 49.
- ↑ 2.0 2.1 2.2 2.3 Cite error: Invalid
<ref>
tag; no text was provided for refs namedref2
- ↑ Cite error: Invalid
<ref>
tag; no text was provided for refs namedref3
References
Cite error: <ref>
tag defined in <references>
has group attribute "" which does not appear in prior text.
Cite error: <ref>
tag defined in <references>
has group attribute "" which does not appear in prior text.
Cite error: <ref>
tag defined in <references>
has group attribute "" which does not appear in prior text.