Difference between revisions of "Gossypium hirsutum"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|227px| * Cotton (Gossypium hirsutum L.) is the single most important spinning fiber that has economic significance wo...")
 
 
(43 intermediate revisions by 8 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
  
−
[[File:Gossypium hirsutum-1.jpg|right|227px|]]
+
[[File:Gossypium hirsutum.png|right|200px|link=Gossypium hirsutum]]
−
* Cotton (Gossypium hirsutum L.) is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development.
+
* '''''Gossypium hirsutum L.''''' is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development. It is one of the most important cash crops that provide fiber to the textile industries around the world. It contributes a major portion to the gross national product (GNP) of many countries<ref name="ref1"/><ref name="ref2"/><ref name="ref3"/>.
−
* It is one of the most important cash crops that provide fiber to the textile industries around the world. According to the rough estimation regarding the world production of cotton, 80% comes from Brazil, China, India, Pakistan, Turkey, USA, and Uzbekistan.
+
* <font color=blue>'''Common Name:'''</font> '''Upland cotton''', '''Mexican cotton'''
−
* This crop contributes a major portion to the gross national product (GNP) of many countries<ref name="ref1"/> <ref name="ref2"/> <ref name="ref3"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3635 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic Stress'''''==
 
=='''''Abiotic Stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 14: Line 14:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 20:
 
|-
 
|-
 
|align="center"| GhUBQ7<ref name="ref1"/>
 
|align="center"| GhUBQ7<ref name="ref1"/>
−
|align="center"| ubiquitin extension protein 7
+
|align="center"| Ubiquitin extension protein 7
 
|
 
|
 
* Leaves & roots under salt stress and drought stress  
 
* Leaves & roots under salt stress and drought stress  
Line 32: Line 32:
 
|-
 
|-
 
|align="center"| GhGAPDH<ref name="ref1"/>
 
|align="center"| GhGAPDH<ref name="ref1"/>
−
|align="center"| glyceraldehyde-3-phosphate dehydroge- nase C subunit
+
|align="center"| Glyceraldehyde-3-phosphate dehydroge- nase C subunit
 
|
 
|
 
* Leaves & roots under salt stress and drought stress  
 
* Leaves & roots under salt stress and drought stress  
Line 44: Line 44:
 
|-
 
|-
 
|align="center"| GhEF1A8<ref name="ref1"/>
 
|align="center"| GhEF1A8<ref name="ref1"/>
−
|align="center"| translation elongation factor 1A-8
+
|align="center"| Translation elongation factor 1A-8
 
|
 
|
 
* Leaves & roots under salt stress and drought stress  
 
* Leaves & roots under salt stress and drought stress  
Line 56: Line 56:
 
|-
 
|-
 
|align="center"| GhTUA10<ref name="ref1"/>
 
|align="center"| GhTUA10<ref name="ref1"/>
−
|align="center"| alpha-tubulin 10
+
|align="center"| Alpha-tubulin 10
 
|
 
|
 
* Roots under salt stress
 
* Roots under salt stress
Line 69: Line 69:
 
|-
 
|-
 
|align="center"| GhCYP1<ref name="ref1"/>
 
|align="center"| GhCYP1<ref name="ref1"/>
−
|align="center"| cydophilin 1
+
|align="center"| Cydophilin 1
 
|
 
|
 
* Roots under drought stress  
 
* Roots under drought stress  
Line 81: Line 81:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 92: Line 93:
 
*'''Email''': zhangb@ecu.edu
 
*'''Email''': zhangb@ecu.edu
 
*'''Institution''': Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India
 
*'''Institution''': Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=8557246666837332822&as_sdt=2005&sciodt=0,5&hl=en'''34'''] (Based on Google Scholar [2017-09-01])
 +
 +
=='''Fiber Development & Somatic Embryogenesis'''==
 +
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| Histone3<ref name="ref2"/>
 +
|align="center"| Histone 3 
 +
|
 +
*Fiber development and somatic embryogenesis
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AF024716 '''AF024716''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TCAAGACTGATTTGCGTTTCCA
 +
* R:GCGCAAAGGTTGGTGTCTTC
 +
|align="center"| 100
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| UBQ7<ref name="ref2"/>
 +
|align="center"| Ubiquitin extension protein 
 +
|
 +
*Fiber development and somatic embryogenesis
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ116441 '''DQ116441''']
 +
|nowrap style="font-size:9pt"|
 +
* F:GAAGGCATTCCACCTGACCAAC
 +
* R:CTTGACCTTCTTCTTCTTGTGCTTG
 +
|align="center"| 198
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| Gbpolyubiquitin-1<ref name="ref2"/>
 +
|align="center"| Fiber polyubiquitin
 +
|
 +
*Fiber development and somatic embryogenesis
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY375335 '''AY375335''']
 +
|nowrap style="font-size:9pt"|
 +
* F:AGCTCGGATACGATTGATAACG
 +
* R:GAAGACGAAGAACAAGGGGAAG
 +
|align="center"| 166
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|}
 +
 +
===Molecular Types===
 +
* mRNA
 +
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': ZHANG XianLong
 +
*'''Email''': xlzhang@mail.hzau.edu.cn
 +
*'''Institution''': National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=8086910040487337246&as_sdt=2005&sciodt=0,5&hl=en'''51'''] (Based on Google Scholar [2017-09-01])
 +
 +
=='''Different Developmental Stages & Tissues'''==
 +
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| GhPP2A1<ref name="ref4"/>
 +
|align="center"| Catalytic subunit of protein phosphatase 2A
 +
|
 +
* Distinct plants organs
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT545658 '''DT545658''']
 +
|nowrap style="font-size:9pt"|
 +
* F:GATCCTTGTGGAGGAGTGGA
 +
* R:GCGAAACAGTTCGACGAGAT
 +
|align="center"| 1301
 +
|align="center"| 60~61
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| GhUBQ14<ref name="ref4"/>
 +
|align="center"| Ubiquilin
 +
|
 +
* Distinct plants organs
 +
* Flower development
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DW505546 '''DW505546''']
 +
|nowrap style="font-size:9pt"|
 +
* F:CAACGCTCCATCTTGTCCTT
 +
* R:TGATCGTCTTTCCCGTAAGC
 +
|align="center"| 1502
 +
|align="center"| 60~61
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| GhACT4<ref name="ref4"/>
 +
|align="center"| Actin gene family
 +
|
 +
*Flower development
 +
*Floral verticils
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY305726 '''AY305726''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TTGCAGACCGTATGAGCAAG
 +
* R:ATCCTCCGATCCAGACACTG
 +
|align="center"| 1700
 +
|align="center"| 60~61
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| GhFBX6<ref name="ref4"/>
 +
|align="center"| F-box family protein
 +
|
 +
*Floral verticils
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DR463903 '''DR463903''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TGCCTGCAGTAAATCTGTGC
 +
* R:GGGTGAAAGGGTTTCCAAAT
 +
|align="center"| 1884
 +
|align="center"| 60~61
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| GhMZA<ref name="ref4"/>
 +
|align="center"| Clathrin adaptor complexes medium subunit family protein
 +
|
 +
*Fruit development
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT571956 '''DT571956''']
 +
|nowrap style="font-size:9pt"|
 +
* F:CCGTCAGACAGATTGGAGGT
 +
* R:AAAGCAACAGCCTCAACGAC
 +
|align="center"| 1853
 +
|align="center"| 60~61
 +
|align="center"| SYBR
 +
|-
 +
|align="center"|  GhPTB<ref name="ref4"/>
 +
|align="center"| Polypyrimidine tract-binding protein homolog
 +
|
 +
*Fruit development
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/DT571956 '''DT571956''']
 +
|nowrap style="font-size:9pt"|
 +
* F:GGTTACCATTGAGGGTGTGG
 +
* R:GTGCACAAAACCAAATGCAG
 +
|align="center"| 1511
 +
|align="center"| 60~61
 +
|align="center"| SYBR
 +
|}
 +
 +
===Molecular Types===
 +
* mRNA
 +
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Marcio Alves-Ferreira
 +
*'''Email''': alvesfer@biologia.ufrj.br
 +
*'''Institution''': Department of Genetics, Federal University of Rio de Janeiro-UFRJ Av Prof Rodolpho Paulo Rocco, s/n - Prédio do CCS Instituto de Biologia, 2oandar - sala A2-93, 219410-970 - Rio de Janeiro, RJ - Brasil
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=6445593680707955809&as_sdt=2005&sciodt=0,5&hl=en'''200'''] (Based on Google Scholar [2017-09-01])
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
Line 98: Line 267:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
 +
Tu L L, Zhang X L, Liu D Q, et al. Suitable internal control genes for qRT-PCR normalization in cotton fiber development and somatic embryogenesis[J]. Chinese Science Bulletin, 2007, 52(22): 3110-3117.
 +
</ref>
 +
<ref name="ref3">
 
Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).  
 
Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).  
 
</ref>
 
</ref>
−
<ref name="ref3">
+
<ref name="ref4">
−
Biotech. 2016 Dec;6(2):217. doi: 10.1007/s13205-016-0534-3. Epub 2016 Oct 7. Review. PubMed PMID: 28330289; PubMed Central PMCID: PMC5055485.
+
Artico S, Nardeli S M, Brilhante O, et al. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data[J]. BMC plant biology, 2010, 10(1): 49.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 +
[[Category:Plants]] [[Category:mRNA]] [[Category:TaqMan]] [[Category:SYBR]]
 +
[[Category:ACT]] [[Category:Cyclophilin]] [[Category:EF1α]] [[Category:F-box]] [[Category:GAPDH]] [[Category:Histone]] [[Category:NADH]] [[Category:PP2A]] [[Category:PTB]] [[Category:Tubulin]] [[Category:Ubiquitin]] [[Category:Ubiquitin]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
 +
 +
[[Category:Different Tissues]]  [[Category:Abiotic Stress]]  [[Category:Different Developmental Stages]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]

Latest revision as of 06:47, 1 September 2017

Description

Gossypium hirsutum.png
  • Gossypium hirsutum L. is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development. It is one of the most important cash crops that provide fiber to the textile industries around the world. It contributes a major portion to the gross national product (GNP) of many countries[1][2][3].
  • Common Name: Upland cotton, Mexican cotton
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
GhUBQ7[1] Ubiquitin extension protein 7
  • Leaves & roots under salt stress and drought stress
 DQ116441
  • F:GAATGTGGCGCCGGGACCTTC
  • R:ACTCAATCCCCACCAGCCTTCTGG
 101 60 TaqMan
GhGAPDH[1] Glyceraldehyde-3-phosphate dehydroge- nase C subunit
  • Leaves & roots under salt stress and drought stress
 FJ415206
  • F:TGATGCCAAGGCTGGAATTGCTT
  • R:GTGTCGGATCAAGTCGATAACACGG
 106 60 TaqMan
GhEF1A8[1] Translation elongation factor 1A-8
  • Leaves & roots under salt stress and drought stress
 DQ174257
  • F:TGAGACAGACTGTTGCTGTTGGTG
  • R:ACCAAAGTTCACTTGCCACCCTTC
 109 60 TaqMan
GhTUA10[1] Alpha-tubulin 10
  • Roots under salt stress
  • Leaves & roots under drought stress
 FJ594490
  • F:CACGTGAAGATCTCGCTGCCCT
  • R:ACGGTACATCCCTCAATACTCCTCC
 104 60 TaqMan
GhCYP1[1] Cydophilin 1
  • Roots under drought stress
 GQ292530
  • F:CACCATGGCCTCAAATCCCAAGGT
  • R:CTCCGCAGTGCGAGGAGTGC
 109 60 TaqMan

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Baohong Zhang
  • Email: zhangb@ecu.edu
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 34 (Based on Google Scholar [2017-09-01])

Fiber Development & Somatic Embryogenesis

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
Histone3[2] Histone 3 
  • Fiber development and somatic embryogenesis
 AF024716
  • F:TCAAGACTGATTTGCGTTTCCA
  • R:GCGCAAAGGTTGGTGTCTTC
 100 60 SYBR
UBQ7[2] Ubiquitin extension protein 
  • Fiber development and somatic embryogenesis
 DQ116441
  • F:GAAGGCATTCCACCTGACCAAC
  • R:CTTGACCTTCTTCTTCTTGTGCTTG
 198 60 SYBR
Gbpolyubiquitin-1[2] Fiber polyubiquitin
  • Fiber development and somatic embryogenesis
 AY375335
  • F:AGCTCGGATACGATTGATAACG
  • R:GAAGACGAAGAACAAGGGGAAG
 166 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: ZHANG XianLong
  • Email: xlzhang@mail.hzau.edu.cn
  • Institution: National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China

Citation Statistics

Cited by 51 (Based on Google Scholar [2017-09-01])

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
GhPP2A1[4] Catalytic subunit of protein phosphatase 2A
  • Distinct plants organs
 DT545658
  • F:GATCCTTGTGGAGGAGTGGA
  • R:GCGAAACAGTTCGACGAGAT
 1301 60~61 SYBR
GhUBQ14[4] Ubiquilin
  • Distinct plants organs
  • Flower development
 DW505546
  • F:CAACGCTCCATCTTGTCCTT
  • R:TGATCGTCTTTCCCGTAAGC
 1502 60~61 SYBR
GhACT4[4] Actin gene family
  • Flower development
  • Floral verticils
 AY305726
  • F:TTGCAGACCGTATGAGCAAG
  • R:ATCCTCCGATCCAGACACTG
 1700 60~61 SYBR
GhFBX6[4] F-box family protein
  • Floral verticils
 DR463903
  • F:TGCCTGCAGTAAATCTGTGC
  • R:GGGTGAAAGGGTTTCCAAAT
 1884 60~61 SYBR
GhMZA[4] Clathrin adaptor complexes medium subunit family protein
  • Fruit development
 DT571956
  • F:CCGTCAGACAGATTGGAGGT
  • R:AAAGCAACAGCCTCAACGAC
 1853 60~61 SYBR
GhPTB[4] Polypyrimidine tract-binding protein homolog
  • Fruit development
 DT571956
  • F:GGTTACCATTGAGGGTGTGG
  • R:GTGCACAAAACCAAATGCAG
 1511 60~61 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Marcio Alves-Ferreira
  • Email: alvesfer@biologia.ufrj.br
  • Institution: Department of Genetics, Federal University of Rio de Janeiro-UFRJ Av Prof Rodolpho Paulo Rocco, s/n - Prédio do CCS Instituto de Biologia, 2oandar - sala A2-93, 219410-970 - Rio de Janeiro, RJ - Brasil

Citation Statistics

Cited by 200 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Wang M, Wang Q, Zhang B. Evaluation and selection of reliable reference genes for gene expression under abiotic stress in cotton (Gossypium hirsutum L.)[J]. Gene, 2013, 530(1): 44-50.
  2. ↑ 2.0 2.1 2.2 2.3 Tu L L, Zhang X L, Liu D Q, et al. Suitable internal control genes for qRT-PCR normalization in cotton fiber development and somatic embryogenesis[J]. Chinese Science Bulletin, 2007, 52(22): 3110-3117.
  3. ↑ Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).
  4. ↑ 4.0 4.1 4.2 4.3 4.4 4.5 Artico S, Nardeli S M, Brilhante O, et al. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data[J]. BMC plant biology, 2010, 10(1): 49.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Gossypium_hirsutum&oldid=8702"