Difference between revisions of "Gossypium hirsutum"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
Line 95: | Line 95: | ||
Cited by '''31''' (Based on Google Scholar [2017-06-16]) | Cited by '''31''' (Based on Google Scholar [2017-06-16]) | ||
+ | =='''Fiber Development & Somatic Embryogenesis'''== | ||
+ | |||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primer | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| Histone3<ref name="ref2"/> | ||
+ | |align="center"| histone 3 | ||
+ | | | ||
+ | *fiber development and somatic embryogenesis | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AF024716 '''AF024716'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TCAAGACTGATTTGCGTTTCCA | ||
+ | * R:GCGCAAAGGTTGGTGTCTTC | ||
+ | |align="center"| 100 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| UBQ7<ref name="ref2"/> | ||
+ | |align="center"| ubiquitin extension protein | ||
+ | | | ||
+ | *fiber development and somatic embryogenesis | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ116441 ''DQ116441'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GAAGGCATTCCACCTGACCAAC | ||
+ | * R:CTTGACCTTCTTCTTCTTGTGCTTG | ||
+ | |align="center"| 198 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| Gbpolyubiquitin-1<ref name="ref2"/> | ||
+ | |align="center"| fiber polyubiquitin | ||
+ | | | ||
+ | *fiber development and somatic embryogenesis | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY375335 '''AY375335'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:AGCTCGGATACGATTGATAACG | ||
+ | * R:GAAGACGAAGAACAAGGGGAAG | ||
+ | |align="center"| 166 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | ===Moleculer Type=== | ||
+ | * mRNA | ||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': ZHANG XianLong | ||
+ | *'''Email''': xlzhang@mail.hzau.edu.cn | ||
+ | *'''Institution''': National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China | ||
=='''References'''== | =='''References'''== |
Revision as of 09:08, 16 June 2017
Contents
Description
- Cotton (Gossypium hirsutum L.) is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development.
- It is one of the most important cash crops that provide fiber to the textile industries around the world. According to the rough estimation regarding the world production of cotton, 80% comes from Brazil, China, India, Pakistan, Turkey, USA, and Uzbekistan.
- This crop contributes a major portion to the gross national product (GNP) of many countries[1] [2] [3].
Abiotic Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GhUBQ7[1] | ubiquitin extension protein 7 |
|
DQ116441 |
|
101 | 60 | TaqMan |
GhGAPDH[1] | glyceraldehyde-3-phosphate dehydroge- nase C subunit |
|
FJ415206 |
|
106 | 60 | TaqMan |
GhEF1A8[1] | translation elongation factor 1A-8 |
|
DQ174257 |
|
109 | 60 | TaqMan |
GhTUA10[1] | alpha-tubulin 10 |
|
FJ594490 |
|
104 | 60 | TaqMan |
GhCYP1[1] | cydophilin 1 |
|
GQ292530 |
|
109 | 60 | TaqMan |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Baohong Zhang
- Email: zhangb@ecu.edu
- Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India
Citation Statistics
Cited by 31 (Based on Google Scholar [2017-06-16])
Fiber Development & Somatic Embryogenesis
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Histone3[2] | histone 3 |
|
AF024716 |
|
100 | 60 | SYBR |
UBQ7[2] | ubiquitin extension protein |
|
DQ116441' |
|
198 | 60 | SYBR |
Gbpolyubiquitin-1[2] | fiber polyubiquitin |
|
AY375335 |
|
166 | 60 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
Contact
- Name: ZHANG XianLong
- Email: xlzhang@mail.hzau.edu.cn
- Institution: National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Wang M, Wang Q, Zhang B. Evaluation and selection of reliable reference genes for gene expression under abiotic stress in cotton (Gossypium hirsutum L.)[J]. Gene, 2013, 530(1): 44-50.
- ↑ 2.0 2.1 2.2 2.3 Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).
- ↑ Biotech. 2016 Dec;6(2):217. doi: 10.1007/s13205-016-0534-3. Epub 2016 Oct 7. Review. PubMed PMID: 28330289; PubMed Central PMCID: PMC5055485.