Difference between revisions of "Gossypium hirsutum"

From ICG
Jump to navigation Jump to search
Line 160: Line 160:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
 +
Tu L L, Zhang X L, Liu D Q, et al. Suitable internal control genes for qRT-PCR normalization in cotton fiber development and somatic embryogenesis[J]. Chinese Science Bulletin, 2007, 52(22): 3110-3117.
 +
</ref>
 +
<ref name="ref3">
 
Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).  
 
Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).  
 
</ref>
 
</ref>
−
<ref name="ref3">
+
<ref name="ref4">
 
Biotech. 2016 Dec;6(2):217. doi: 10.1007/s13205-016-0534-3. Epub 2016 Oct 7. Review. PubMed PMID: 28330289; PubMed Central PMCID: PMC5055485.
 
Biotech. 2016 Dec;6(2):217. doi: 10.1007/s13205-016-0534-3. Epub 2016 Oct 7. Review. PubMed PMID: 28330289; PubMed Central PMCID: PMC5055485.
 
</ref>
 
</ref>
 
</references>
 
</references>
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
=='''References'''==

Revision as of 09:08, 16 June 2017

Description

Gossypium hirsutum-1.jpg
  • Cotton (Gossypium hirsutum L.) is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development.
  • It is one of the most important cash crops that provide fiber to the textile industries around the world. According to the rough estimation regarding the world production of cotton, 80% comes from Brazil, China, India, Pakistan, Turkey, USA, and Uzbekistan.
  • This crop contributes a major portion to the gross national product (GNP) of many countries[1] [2] [3].

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GhUBQ7[1] ubiquitin extension protein 7
  • Leaves & roots under salt stress and drought stress
 DQ116441
  • F:GAATGTGGCGCCGGGACCTTC
  • R:ACTCAATCCCCACCAGCCTTCTGG
 101 60 TaqMan
GhGAPDH[1] glyceraldehyde-3-phosphate dehydroge- nase C subunit
  • Leaves & roots under salt stress and drought stress
 FJ415206
  • F:TGATGCCAAGGCTGGAATTGCTT
  • R:GTGTCGGATCAAGTCGATAACACGG
 106 60 TaqMan
GhEF1A8[1] translation elongation factor 1A-8
  • Leaves & roots under salt stress and drought stress
 DQ174257
  • F:TGAGACAGACTGTTGCTGTTGGTG
  • R:ACCAAAGTTCACTTGCCACCCTTC
 109 60 TaqMan
GhTUA10[1] alpha-tubulin 10
  • Roots under salt stress
  • Leaves & roots under drought stress
 FJ594490
  • F:CACGTGAAGATCTCGCTGCCCT
  • R:ACGGTACATCCCTCAATACTCCTCC
 104 60 TaqMan
GhCYP1[1] cydophilin 1
  • Roots under drought stress
 GQ292530
  • F:CACCATGGCCTCAAATCCCAAGGT
  • R:CTCCGCAGTGCGAGGAGTGC
 109 60 TaqMan

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Baohong Zhang
  • Email: zhangb@ecu.edu
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-06-16])

Fiber Development & Somatic Embryogenesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Histone3[2] histone 3 
  • fiber development and somatic embryogenesis
 AF024716
  • F:TCAAGACTGATTTGCGTTTCCA
  • R:GCGCAAAGGTTGGTGTCTTC
 100 60 SYBR
UBQ7[2] ubiquitin extension protein 
  • fiber development and somatic embryogenesis
 DQ116441'
  • F:GAAGGCATTCCACCTGACCAAC
  • R:CTTGACCTTCTTCTTCTTGTGCTTG
 198 60 SYBR
Gbpolyubiquitin-1[2] fiber polyubiquitin
  • fiber development and somatic embryogenesis
 AY375335
  • F:AGCTCGGATACGATTGATAACG
  • R:GAAGACGAAGAACAAGGGGAAG
 166 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: ZHANG XianLong
  • Email: xlzhang@mail.hzau.edu.cn
  • Institution: National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Wang M, Wang Q, Zhang B. Evaluation and selection of reliable reference genes for gene expression under abiotic stress in cotton (Gossypium hirsutum L.)[J]. Gene, 2013, 530(1): 44-50.
  2. ↑ 2.0 2.1 2.2 2.3 Tu L L, Zhang X L, Liu D Q, et al. Suitable internal control genes for qRT-PCR normalization in cotton fiber development and somatic embryogenesis[J]. Chinese Science Bulletin, 2007, 52(22): 3110-3117.
  3. ↑ Yan R, Liang C, Meng Z, Malik W, Zhu T, Zong X, Guo S, Zhang R. Progress in genome sequencing will accelerate molecular breeding in cotton (Gossypium spp.).

Cite error: <ref> tag with name "ref4" defined in <references> is not used in prior text.

References

Retrieved from "http://192.168.164.12:9052/index.php?title=Gossypium_hirsutum&oldid=374"