Gossypium hirsutum

Description

• Cotton (Gossypium hirsutum L.) is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development.
• It is one of the most important cash crops that provide fiber to the textile industries around the world. According to the rough estimation regarding the world production of cotton, 80% comes from Brazil, China, India, Pakistan, Turkey, USA, and Uzbekistan.
• This crop contributes a major portion to the gross national product (GNP) of many countries .

Abiotic Stress

Reference Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
GhUBQ7	ubiquitin extension protein 7	Leaves & roots under salt stress and drought stress	DQ116441	F:GAATGTGGCGCCGGGACCTTC R:ACTCAATCCCCACCAGCCTTCTGG	101	60	TaqMan
GhGAPDH	glyceraldehyde-3-phosphate dehydroge- nase C subunit	Leaves & roots under salt stress and drought stress	FJ415206	F:TGATGCCAAGGCTGGAATTGCTT R:GTGTCGGATCAAGTCGATAACACGG	106	60	TaqMan
GhEF1A8	translation elongation factor 1A-8	Leaves & roots under salt stress and drought stress	DQ174257	F:TGAGACAGACTGTTGCTGTTGGTG R:ACCAAAGTTCACTTGCCACCCTTC	109	60	TaqMan
GhTUA10	alpha-tubulin 10	Roots under salt stress Leaves & roots under drought stress	FJ594490	F:CACGTGAAGATCTCGCTGCCCT R:ACGGTACATCCCTCAATACTCCTCC	104	60	TaqMan
GhCYP1	cydophilin 1	Roots under drought stress	GQ292530	F:CACCATGGCCTCAAATCCCAAGGT R:CTCCGCAGTGCGAGGAGTGC	109	60	TaqMan

Moleculer Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference
• BestKeeper method && Related Reference
• ΔCt approach method && Related Reference

Contact

• Name: Baohong Zhang
• Email: zhangb@ecu.edu
• Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India