Gossypium hirsutum

From ICG
Jump to navigation Jump to search

Description

Gossypium hirsutum-1.jpg
  • Cotton (Gossypium hirsutum L.) is the single most important spinning fiber that has economic significance worldwide. Cotton is one of the most value-added crops and an excellent model system for the analysis of polyploidization and cell development.
  • It is one of the most important cash crops that provide fiber to the textile industries around the world. According to the rough estimation regarding the world production of cotton, 80% comes from Brazil, China, India, Pakistan, Turkey, USA, and Uzbekistan.
  • This crop contributes a major portion to the gross national product (GNP) of many countries[1] [2] [3].

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GhUBQ7[1] ubiquitin extension protein 7
  • Leaves & roots under salt stress and drought stress
DQ116441
  • F:GAATGTGGCGCCGGGACCTTC
  • R:ACTCAATCCCCACCAGCCTTCTGG
101 60 TaqMan
GhGAPDH[1] glyceraldehyde-3-phosphate dehydroge- nase C subunit
  • Leaves & roots under salt stress and drought stress
FJ415206
  • F:TGATGCCAAGGCTGGAATTGCTT
  • R:GTGTCGGATCAAGTCGATAACACGG
106 60 TaqMan
GhEF1A8[1] translation elongation factor 1A-8
  • Leaves & roots under salt stress and drought stress
DQ174257
  • F:TGAGACAGACTGTTGCTGTTGGTG
  • R:ACCAAAGTTCACTTGCCACCCTTC
109 60 TaqMan
GhTUA10[1] alpha-tubulin 10
  • Roots under salt stress
  • Leaves & roots under drought stress
FJ594490
  • F:CACGTGAAGATCTCGCTGCCCT
  • R:ACGGTACATCCCTCAATACTCCTCC
104 60 TaqMan
GhCYP1[1] cydophilin 1
  • Roots under drought stress
GQ292530
  • F:CACCATGGCCTCAAATCCCAAGGT
  • R:CTCCGCAGTGCGAGGAGTGC
109 60 TaqMan

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Baohong Zhang
  • Email: zhangb@ecu.edu
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-06-16])

Fiber Development & Somatic Embryogenesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Histone3[2] histone 3 
  • fiber development and somatic embryogenesis
AF024716
  • F:TCAAGACTGATTTGCGTTTCCA
  • R:GCGCAAAGGTTGGTGTCTTC
100 60 SYBR
UBQ7[2] ubiquitin extension protein 
  • fiber development and somatic embryogenesis
DQ116441
  • F:GAAGGCATTCCACCTGACCAAC
  • R:CTTGACCTTCTTCTTCTTGTGCTTG
198 60 SYBR
Gbpolyubiquitin-1[2] fiber polyubiquitin
  • fiber development and somatic embryogenesis
AY375335
  • F:AGCTCGGATACGATTGATAACG
  • R:GAAGACGAAGAACAAGGGGAAG
166 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: ZHANG XianLong
  • Email: xlzhang@mail.hzau.edu.cn
  • Institution: National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China

Citation Statistics

Cited by 51 (Based on Google Scholar [2017-06-16])

Different Organs & Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GhPP2A1[1] catalytic subunit of protein phosphatase 2A
  • distinct plants organs
DT545658
  • F:GATCCTTGTGGAGGAGTGGA
  • R:GCGAAACAGTTCGACGAGAT
1301 60~61 SYBR
GhUBQ14[1]
  • distinct plants organs
  • flower development
DW505546
  • F:CAACGCTCCATCTTGTCCTT
  • R:TGATCGTCTTTCCCGTAAGC
1502 60~61 SYBR
GhACT4[1] actin gene family
  • flower development
  • floral verticils
AY305726
  • F:TTGCAGACCGTATGAGCAAG
  • R:ATCCTCCGATCCAGACACTG
1700 60~61 SYBR
GhFBX6[1] F-box family protein
  • floral verticils
DR463903
  • F:TGCCTGCAGTAAATCTGTGC
  • R:GGGTGAAAGGGTTTCCAAAT
1884 60~61 SYBR
GhMZA[1] clathrin adaptor complexes medium subunit family protein
  • fruit development
DT571956
  • F:CCGTCAGACAGATTGGAGGT
  • R:AAAGCAACAGCCTCAACGAC
1853 60~61 SYBR
GhPTB[1] polypyrimidine tract-binding protein homolog
  • fruit development
DT571956
  • F:GGTTACCATTGAGGGTGTGG
  • R:GTGCACAAAACCAAATGCAG
1511 60~61 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Marcio Alves-Ferreira
  • Email: alvesfer@biologia.ufrj.br
  • Institution: Department of Genetics, Federal University of Rio de Janeiro-UFRJ Av Prof Rodolpho Paulo Rocco, s/n - Prédio do CCS Instituto de Biologia, 2oandar - sala A2-93, 219410-970 - Rio de Janeiro, RJ - Brasil

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Artico S, Nardeli S M, Brilhante O, et al. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data[J]. BMC plant biology, 2010, 10(1): 49.
  2. 2.0 2.1 2.2 2.3 Cite error: Invalid <ref> tag; no text was provided for refs named ref2
  3. Cite error: Invalid <ref> tag; no text was provided for refs named ref3

References

Cite error: <ref> tag defined in <references> has group attribute "" which does not appear in prior text.
Cite error: <ref> tag defined in <references> has group attribute "" which does not appear in prior text.
Cite error: <ref> tag defined in <references> has group attribute "" which does not appear in prior text.

References