Difference between revisions of "Haliotis rufescens"

From ICG
Jump to navigation Jump to search
Line 4: Line 4:
 
* In red abalone, full sex differentiation usually occurs at around 50 mm of shell length based on histological analysis. However, gonadal primordia have been found in females with 26 mm of shell length. At the same time, there is an interest in improving the rate of growth of red abalone through neuropeptide characterization.
 
* In red abalone, full sex differentiation usually occurs at around 50 mm of shell length based on histological analysis. However, gonadal primordia have been found in females with 26 mm of shell length. At the same time, there is an interest in improving the rate of growth of red abalone through neuropeptide characterization.
 
* The longitudinal cross-section of the abalone shell (H. rufescens) shows two types of microstructure: an outer prismatic layer (calcite); and an inner nacreous layer (aragonite). The two forms of CaCO3, calcite (rhombohedral) and aragonite (orthorhombic) constitute the inorganic component of this ceramic/organic composite (95 wt% ceramic, 5 wt% organic material).  <ref name="ref1"/> <ref name="ref2"/>.
 
* The longitudinal cross-section of the abalone shell (H. rufescens) shows two types of microstructure: an outer prismatic layer (calcite); and an inner nacreous layer (aragonite). The two forms of CaCO3, calcite (rhombohedral) and aragonite (orthorhombic) constitute the inorganic component of this ceramic/organic composite (95 wt% ceramic, 5 wt% organic material).  <ref name="ref1"/> <ref name="ref2"/>.
=='''''Different Experimental Conditions'''''==
+
=='''''Different Tissues'''''==
 
===Reference Genes===
 
===Reference Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"

Revision as of 16:59, 19 June 2017

Description

REFqPCR2014005-1.jpg
  • The red abalone Haliotis rufescens is one of the most important species for aquaculture in Baja California, México. there is an increasing interest in studying aspects such as reproduction, thermoregulation and endocrinology. Currently, thereis anapparent skewed sex ratio, where males are changing to females, and this affects broodstock availability to obtain larvae at commercial scale.
  • In red abalone, full sex differentiation usually occurs at around 50 mm of shell length based on histological analysis. However, gonadal primordia have been found in females with 26 mm of shell length. At the same time, there is an interest in improving the rate of growth of red abalone through neuropeptide characterization.
  • The longitudinal cross-section of the abalone shell (H. rufescens) shows two types of microstructure: an outer prismatic layer (calcite); and an inner nacreous layer (aragonite). The two forms of CaCO3, calcite (rhombohedral) and aragonite (orthorhombic) constitute the inorganic component of this ceramic/organic composite (95 wt% ceramic, 5 wt% organic material). [1] [2].

Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
HPRTI[1] hypoxanthine phosphoribosyltransferase 1
  • Gill and gonad/digestive gland
KJ188156
  • F:ACGACATCTCAACAGGGAACATC
  • R:GACTTGGGCTTCACTTCCTTCA
151 60 SYBR
RPL5[1] ribosomal protein L5
  • Head and gonad/digestive gland
KJ188157
  • F:TCACCAACAAGGACATCATTTGTC
  • R:CAGGAGGAGTCCAGTGCAGTATG
152 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Miguel A. Del Río-Portilla
  • Email: mdelrio@cicese.mx
  • Institution: Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens.

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Lopez-Landavery EA, Portillo-Lopez A, Gallardo-Escarate C, Del Rio-Portilla MA (2014) Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens (Mollusca, Vetigastropoda; Swainson, 1822). Gene 549, 258-265.
  2. Menig R, Meyers MH, Meyers MA, Vecchio KS (2000) Quasi-static and dynamic mechanical response of Haliotis rufescens (abalone) shells. Acta Materialia 48, 2383-2398.