Difference between revisions of "Haliotis rufescens"

From ICG
Jump to navigation Jump to search
 
(14 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2014005-1.jpg|right|327px|]]
+
[[File:Haliotis rufescens.png|right|200px|link=Haliotis rufescens]]
* The red abalone Haliotis rufescens is one of the most important species for aquaculture in Baja California, México. there is an increasing interest in studying aspects such as reproduction, thermoregulation and endocrinology. Currently, thereis anapparent skewed sex ratio, where males are changing to females, and this affects broodstock availability to obtain larvae at commercial scale.
+
*'''''Haliotis rufescens''''' is one of the most important species for aquaculture in Baja California, México. The longitudinal cross-section of ''H. rufescens'' shows two types of microstructure: an outer prismatic layer, and an inner nacreous layer. The two forms of CaCO3, calcite and aragonite constitute the inorganic component of this ceramic/organic composite. Currently, there is an apparent skewed sex ratio, where males are changing to females, and this affects broodstock availability to obtain larvae at commercial scale. Increasing interest has been put in studying aspects such as reproduction, thermoregulation and endocrinology<ref name="ref1"/><ref name="ref2"/>.
* In red abalone, full sex differentiation usually occurs at around 50 mm of shell length based on histological analysis. However, gonadal primordia have been found in females with 26 mm of shell length. At the same time, there is an interest in improving the rate of growth of red abalone through neuropeptide characterization.
+
* <font color=blue>'''Common Name:'''</font> '''Red abalone'''
* The longitudinal cross-section of the abalone shell (H. rufescens) shows two types of microstructure: an outer prismatic layer (calcite); and an inner nacreous layer (aragonite). The two forms of CaCO3, calcite (rhombohedral) and aragonite (orthorhombic) constitute the inorganic component of this ceramic/organic composite (95 wt% ceramic, 5 wt% organic material). <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6454 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
 
=='''''Different Tissues'''''==
 
=='''''Different Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 12: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 18: Line 19:
 
|-
 
|-
 
|align="center"| HPRTI<ref name="ref1"/>
 
|align="center"| HPRTI<ref name="ref1"/>
|align="center"| hypoxanthine phosphoribosyltransferase 1
+
|align="center"| Hypoxanthine phosphoribosyltransferase 1
 
|
 
|
 
* Gill and gonad/digestive gland  
 
* Gill and gonad/digestive gland  
Line 30: Line 31:
 
|-
 
|-
 
|align="center"| RPL5<ref name="ref1"/>
 
|align="center"| RPL5<ref name="ref1"/>
|align="center"| ribosomal protein L5
+
|align="center"| Ribosomal protein L5
 
|
 
|
 
* Head and gonad/digestive gland  
 
* Head and gonad/digestive gland  
Line 42: Line 43:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 54: Line 56:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''5''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=4920327290200415835&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 65: Line 67:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]][[Category:mRNA]][[Category:SYBR]]
 
[[Category:Animals]][[Category:mRNA]][[Category:SYBR]]
 
[[Category:HPRT]] [[Category:RPL]]
 
[[Category:HPRT]] [[Category:RPL]]
 +
[[Category:Different Tissues]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 08:21, 1 September 2017

Description

Haliotis rufescens.png
  • Haliotis rufescens is one of the most important species for aquaculture in Baja California, México. The longitudinal cross-section of H. rufescens shows two types of microstructure: an outer prismatic layer, and an inner nacreous layer. The two forms of CaCO3, calcite and aragonite constitute the inorganic component of this ceramic/organic composite. Currently, there is an apparent skewed sex ratio, where males are changing to females, and this affects broodstock availability to obtain larvae at commercial scale. Increasing interest has been put in studying aspects such as reproduction, thermoregulation and endocrinology[1][2].
  • Common Name: Red abalone
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HPRTI[1] Hypoxanthine phosphoribosyltransferase 1
  • Gill and gonad/digestive gland
KJ188156
  • F:ACGACATCTCAACAGGGAACATC
  • R:GACTTGGGCTTCACTTCCTTCA
151 60 SYBR
RPL5[1] Ribosomal protein L5
  • Head and gonad/digestive gland
KJ188157
  • F:TCACCAACAAGGACATCATTTGTC
  • R:CAGGAGGAGTCCAGTGCAGTATG
152 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Miguel A. Del Río-Portilla
  • Email: mdelrio@cicese.mx
  • Institution: Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens.

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Lopez-Landavery EA, Portillo-Lopez A, Gallardo-Escarate C, Del Rio-Portilla MA (2014) Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens (Mollusca, Vetigastropoda; Swainson, 1822). Gene 549, 258-265.
  2. Menig R, Meyers MH, Meyers MA, Vecchio KS (2000) Quasi-static and dynamic mechanical response of Haliotis rufescens (abalone) shells. Acta Materialia 48, 2383-2398.

Categories