Difference between revisions of "Helicoverpa armigera"

From ICG
Jump to navigation Jump to search
 
(23 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015004-1.jpg|right|227px|]]
+
[[File:Helicoverpa armigera.png|right|200px|link=Helicoverpa armigera]]
* Helicoverpa armigera (Lepidoptera: Noctuidae), the boll worm or corn ear worm, has a widespread distribution in tropical, subtropical and warm temperate regions, and is an important pest of many crop plants.
+
* '''''Helicoverpa armigera''''', the cotton bollworm or corn ear worm, is one of the most serious agricultural pests in Asia, Africa, southern Europe and Australia. Due to heavy selection pressure over the past 40 years, it has developed resistance to organochlorine, carbamate, organophosphate and pyrethroid insecticides in many countries and has begun to show some tolerance to newer chemistries such as fipronil, chlorfenapyr, spinosad and indoxacarb. The failure of insecticides to control resistant H. armigera has been a strong incentive for the development and adoption of Bt cotton genetically engineered to withstand bollworm attack<ref name="ref1"/> <ref name="ref2"/>.
* The cotton bollworm, Helicoverpa armigera (Hu¨bner) (Lepidoptera: Noctuidae), is one of the most serious agricultural pests in Asia, Africa, southern Europe and Australia. Due to heavy selection pressure over the past 40 years, it has developed resistance to organochlorine, carbamate, organophosphate and pyrethroid insecticides in many countries and has begun to show some tolerance to newer chemistries such as fipronil, chlorfenapyr, spinosad and indoxacarb. The failure of insecticides to control resistant H. armigera has been a strong incentive for the development and adoption of Bt cotton genetically engineered to withstand bollworm attack.
+
* <font color=blue>'''Common Name:'''</font> '''Cotton bollworm'''
* RecentstudieshavefocusedondeterminingfunctionalgenesandmicroRNAsinthepestHelicoverpa armigera (Lepidoptera: Noctuidae). Most of these studies used quantitative real-time PCR (qRT-PCR). Suitable reference genes are necessary to normalize gene expression data of qRT-PCR. However, a comprehensive study on the reference genes in H. armigera remains lacking. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=29058 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Biotic and Abiotic conditions'''''==
 
=='''''Different Biotic and Abiotic conditions'''''==
===Reference Genes===
+
===Internal Control Genes===
  
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 14: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 20:
 
|-
 
|-
 
|align="center"| RPL32<ref name="ref1"/>
 
|align="center"| RPL32<ref name="ref1"/>
|align="center"| ribosomal protein L32 (RPL32)
+
|align="center"| Ribosomal protein L32
 
|
 
|
 
* Universal reference gene (especially for insecticide treatment)  
 
* Universal reference gene (especially for insecticide treatment)  
Line 26: Line 26:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CATCAATCGGATCGCTATG
 
* F:CATCAATCGGATCGCTATG
* R:CATCAATCGGATCGCTATG
+
* R:CCATTGGGTAGCATGTGAC
 
|align="center"|  152  
 
|align="center"|  152  
 
|align="center"| 60
 
|align="center"| 60
Line 32: Line 32:
 
|-
 
|-
 
|align="center"| RPS15<ref name="ref1"/>
 
|align="center"| RPS15<ref name="ref1"/>
|align="center"| ribosomal protein S15 (RpS15)
+
|align="center"| Ribosomal protein S15
 
|
 
|
 
* Different developmental stages & larvae tissues
 
* Different developmental stages & larvae tissues
Line 39: Line 39:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CTGAGGTCGATGAAACTCTC
 
* F:CTGAGGTCGATGAAACTCTC
* R:CTGAGGTCGATGAAACTCTC
+
* R:CTCCATGAGTTGCTCATTG
 
|align="center"|  107  
 
|align="center"|  107  
 
|align="center"| 60
 
|align="center"| 60
Line 45: Line 45:
 
|-
 
|-
 
|align="center"| RPL27<ref name="ref1"/>
 
|align="center"| RPL27<ref name="ref1"/>
|align="center"| ribosomal protein L27  
+
|align="center"| Ribosomal protein L27  
 
|
 
|
 
* Adult tissues
 
* Adult tissues
Line 53: Line 53:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ACAGGTATCCCCGCAAAGTGC
 
* F:ACAGGTATCCCCGCAAAGTGC
* R:ACAGGTATCCCCGCAAAGTGC
+
* R:GTCCTTGGCGCTGAACTTCTC
 
|align="center"|  155  
 
|align="center"|  155  
 
|align="center"| 60
 
|align="center"| 60
Line 59: Line 59:
 
|-
 
|-
 
|align="center"| 28S<ref name="ref1"/>
 
|align="center"| 28S<ref name="ref1"/>
|align="center"|  28S ribosomal RNA gene, partial sequence
+
|align="center"|  28S ribosomal RNA
 
|
 
|
 
* Adult tissues
 
* Adult tissues
Line 67: Line 67:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CGATAGCGAACAAGTACCGT
 
* F:CGATAGCGAACAAGTACCGT
* R:CGATAGCGAACAAGTACCGT
+
* R:TTCGAGTTTCGCAGGTTTAC
 
|align="center"|  100  
 
|align="center"|  100  
 
|align="center"| 60
 
|align="center"| 60
Line 73: Line 73:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 86: Line 87:
 
*'''Institution''': Department of Entomology, China Agricultural University, Beijing 100193, China
 
*'''Institution''': Department of Entomology, China Agricultural University, Beijing 100193, China
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''351''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=9792030993970937654&as_sdt=2005&sciodt=0,5&hl=en '''28'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Bown DP, Wilkinson HS, Gatehouse JA (1997) Differentially regulated inhibitor-sensitive and insensitive protease genes from the phytophagous insect pest, Helicoverpa armigara, are members of complex multigene families. Insect Biochemistry and Molecular Biology 27, 625-638.
+
Zhang S, An S, Li Z, et al. (2015) Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 555, 393-402.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Zhang S, An S, Li Z, et al. (2015) Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 555, 393-402.
+
Bown DP, Wilkinson HS, Gatehouse JA (1997) Differentially regulated inhibitor-sensitive and insensitive protease genes from the phytophagous insect pest, Helicoverpa armigara, are members of complex multigene families. Insect Biochemistry and Molecular Biology 27, 625-638.
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
[[Category:mRNA]] 
+
[[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:Other rRNA]] [[Category:RPL]] [[Category:RPL]] [[Category:RPS]][[Category:Biotic Stress]]  [[Category:Abiotic Stress]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 08:24, 1 September 2017

Description

Helicoverpa armigera.png
  • Helicoverpa armigera, the cotton bollworm or corn ear worm, is one of the most serious agricultural pests in Asia, Africa, southern Europe and Australia. Due to heavy selection pressure over the past 40 years, it has developed resistance to organochlorine, carbamate, organophosphate and pyrethroid insecticides in many countries and has begun to show some tolerance to newer chemistries such as fipronil, chlorfenapyr, spinosad and indoxacarb. The failure of insecticides to control resistant H. armigera has been a strong incentive for the development and adoption of Bt cotton genetically engineered to withstand bollworm attack[1] [2].
  • Common Name: Cotton bollworm
  • NCBI Taxonomy

Different Biotic and Abiotic conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL32[1] Ribosomal protein L32
  • Universal reference gene (especially for insecticide treatment)
JQ744274.1
  • F:CATCAATCGGATCGCTATG
  • R:CCATTGGGTAGCATGTGAC
152 60 SYBR
RPS15[1] Ribosomal protein S15
  • Different developmental stages & larvae tissues
  • Insecticide & temperature treatment
AY818611.1
  • F:CTGAGGTCGATGAAACTCTC
  • R:CTCCATGAGTTGCTCATTG
107 60 SYBR
RPL27[1] Ribosomal protein L27
  • Adult tissues
  • Nuclear polyhedrosis virus infection
  • Temperature treatment
DQ875214.1
  • F:ACAGGTATCCCCGCAAAGTGC
  • R:GTCCTTGGCGCTGAACTTCTC
155 60 SYBR
28S[1] 28S ribosomal RNA
  • Adult tissues
  • Nuclear polyhedrosis virus infection
  • Temperature treatment
GU350477.1
  • F:CGATAGCGAACAAGTACCGT
  • R:TTCGAGTTTCGCAGGTTTAC
100 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaoxia Liu
  • Email: liuxiaoxia611@cau.edu.cn
  • Institution: Department of Entomology, China Agricultural University, Beijing 100193, China

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Zhang S, An S, Li Z, et al. (2015) Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 555, 393-402.
  2. Bown DP, Wilkinson HS, Gatehouse JA (1997) Differentially regulated inhibitor-sensitive and insensitive protease genes from the phytophagous insect pest, Helicoverpa armigara, are members of complex multigene families. Insect Biochemistry and Molecular Biology 27, 625-638.

Categories