Difference between revisions of "Helicoverpa armigera"

From ICG
Jump to navigation Jump to search
Line 100: Line 100:
  
 
[[Category:Animals]]
 
[[Category:Animals]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:42, 19 June 2017

Description

REFqPCR2015004-1.jpg
  • Helicoverpa armigera (Lepidoptera: Noctuidae), the boll worm or corn ear worm, has a widespread distribution in tropical, subtropical and warm temperate regions, and is an important pest of many crop plants.
  • The cotton bollworm, Helicoverpa armigera (Hu¨bner) (Lepidoptera: Noctuidae), is one of the most serious agricultural pests in Asia, Africa, southern Europe and Australia. Due to heavy selection pressure over the past 40 years, it has developed resistance to organochlorine, carbamate, organophosphate and pyrethroid insecticides in many countries and has begun to show some tolerance to newer chemistries such as fipronil, chlorfenapyr, spinosad and indoxacarb. The failure of insecticides to control resistant H. armigera has been a strong incentive for the development and adoption of Bt cotton genetically engineered to withstand bollworm attack.
  • RecentstudieshavefocusedondeterminingfunctionalgenesandmicroRNAsinthepestHelicoverpa armigera (Lepidoptera: Noctuidae). Most of these studies used quantitative real-time PCR (qRT-PCR). Suitable reference genes are necessary to normalize gene expression data of qRT-PCR. However, a comprehensive study on the reference genes in H. armigera remains lacking. [1] [2].

Different Biotic and Abiotic conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL32[1] ribosomal protein L32 (RPL32)
  • Universal reference gene (especially for insecticide treatment)
JQ744274.1
  • F:CATCAATCGGATCGCTATG
  • R:CATCAATCGGATCGCTATG
152 60 SYBR
RPS15[1] ribosomal protein S15 (RpS15)
  • Different developmental stages & larvae tissues
  • Insecticide & temperature treatment
AY818611.1
  • F:CTGAGGTCGATGAAACTCTC
  • R:CTGAGGTCGATGAAACTCTC
107 60 SYBR
RPL27[1] ribosomal protein L27
  • Adult tissues
  • Nuclear polyhedrosis virus infection
  • Temperature treatment
DQ875214.1
  • F:ACAGGTATCCCCGCAAAGTGC
  • R:ACAGGTATCCCCGCAAAGTGC
155 60 SYBR
28S[1] 28S ribosomal RNA gene, partial sequence
  • Adult tissues
  • Nuclear polyhedrosis virus infection
  • Temperature treatment
GU350477.1
  • F:CGATAGCGAACAAGTACCGT
  • R:CGATAGCGAACAAGTACCGT
100 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaoxia Liu
  • Email: liuxiaoxia611@cau.edu.cn
  • Institution: Department of Entomology, China Agricultural University, Beijing 100193, China

Citation Statistics

Cited by 351 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Bown DP, Wilkinson HS, Gatehouse JA (1997) Differentially regulated inhibitor-sensitive and insensitive protease genes from the phytophagous insect pest, Helicoverpa armigara, are members of complex multigene families. Insect Biochemistry and Molecular Biology 27, 625-638.
  2. Zhang S, An S, Li Z, et al. (2015) Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 555, 393-402.