Difference between revisions of "Hippoglossus hippoglossus"

From ICG
Jump to navigation Jump to search
 
(10 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Hippoglossus hippoglossus.png|right|200px|link=Hippoglossus hippoglossus]]
[[File:Hippoglossus hippoglossus-1.jpg|right|327px|]]
+
*'''''Hippoglossus hippoglossus''''' is a flatfish of the family Pleuronectidae. It is demersal fish living on or near sand, gravel or clay bottoms at depths of between 50 and 2,000m. It is among the largest teleost (bony) fish in the world, and is an endangered species due to a slow rate of growth and previous overfishing. In addition, as it reaches considerably big size at sexual maturity the handling is labor-intensive and broodstock maintenance is costly<ref name="ref1"/><ref name="ref2"/>.
* Atlantic halibut (Hippoglossus hippoglossus L.) is an interesting species for aquaculture because of its high filet outcome, high market value, low annual catches, rapid growth, and low mortalities during the ongrowing stage.
+
* <font color=blue>'''Common Name:'''</font> '''Atlantic halibut'''
* Atlantic halibut belongs to fishes most difficult to reproduce in captivity as they usually do not spawn spontaneously and synchronously, hence collecting fertilizable eggs requires substantial expertise. In addition, as it reaches considerably big size at sexual maturity the handling is labor-intensive and broodstock maintenance is costly<ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8267 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Development & Tissues'''''==
 
=='''''Different Development & Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 70: Line 70:
 
*'''Institution''': Institute of Marine Research, PO Box 1870 Nordnes, N-5817 Bergen, Norway
 
*'''Institution''': Institute of Marine Research, PO Box 1870 Nordnes, N-5817 Bergen, Norway
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''50''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?hl=en&as_sdt=2005&sciodt=0,5&cites=8784513374348353585&scipsc= '''51'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 81: Line 81:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Animals]] [[Category:mRNA]] [[Category:TaqMan]]
+
=='''Categories'''==
[[Category:EF1α]] [[Category:RPL]] [[Category:Ubiquitin]]
+
[[Category:Animals]]
 +
[[Category:mRNA]]
 +
[[Category:TaqMan]]
 +
[[Category:EF1α]]
 +
[[Category:RPL]]
 +
[[Category:Ubiquitin]]
 +
 
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 07:21, 1 September 2017

Description

Hippoglossus hippoglossus.png
  • Hippoglossus hippoglossus is a flatfish of the family Pleuronectidae. It is demersal fish living on or near sand, gravel or clay bottoms at depths of between 50 and 2,000m. It is among the largest teleost (bony) fish in the world, and is an endangered species due to a slow rate of growth and previous overfishing. In addition, as it reaches considerably big size at sexual maturity the handling is labor-intensive and broodstock maintenance is costly[1][2].
  • Common Name: Atlantic halibut
  • NCBI Taxonomy

Different Development & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1A1[1] Elongation factor 1 alpha
  • Before activation of zygotic transcription;
  • after hatching;
  • various halibut organs,both in non-injected fish and in mock- and NNV-injected fish
EU561358
  • F:CCATGGTTGTGGAGTCCTTCTC
  • R:GATGACACCGACAGCCACTGT
NA 60 TaqMan
UbcE[1] Ubiquitin-conjugating enzyme E2L 3
  • Before activation of zygotic transcription
FJ008912
  • F:GAACTGGAAACCAGCGACAAA
  • R:CGCTCACCAGAGCAATGAGA
NA 60 TaqMan
RPL7[1] Ribosomal protein L7
  • After hatching;
  • various halibut organs, both in non-injected fish and in mock- and NNV-injected fish
FJ008911
  • F:GAAGGCTCTCGGCAAATATGG
  • R:GCCAACTGTGTAAATCTCATGGAT
NA 60 TaqMan

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sonal Patel
  • Email: aina-cathrine.oevergaard@imr.no
  • Institution: Institute of Marine Research, PO Box 1870 Nordnes, N-5817 Bergen, Norway

Citation Statistics

Cited by 51 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Øvergård A C, Nerland A H, Patel S. Evaluation of potential reference genes for real time RT-PCR studies in Atlantic halibut (Hippoglossus Hippoglossus L.); during development, in tissues of healthy and NNV-injected fish, and in anterior kidney leucocytes[J]. BMC molecular biology, 2010, 11(1): 36.
  2. Skaalsvik TH, Bolla SL, Thornqvist PO, Babiak I.Theriogenology. 2015 Jan 1;83(1):38-47.PMID: 25459032.

Categories