Difference between revisions of "Hippoglossus hippoglossus"

Revision as of 15:05, 23 June 2017

Atlantic halibut (Hippoglossus hippoglossus L.) is an interesting species for aquaculture because of its high filet outcome, high market value, low annual catches, rapid growth, and low mortalities during the ongrowing stage.
Atlantic halibut belongs to fishes most difficult to reproduce in captivity as they usually do not spawn spontaneously and synchronously, hence collecting fertilizable eggs requires substantial expertise. In addition, as it reaches considerably big size at sexual maturity the handling is labor-intensive and broodstock maintenance is costly^[1] ^[2].

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
EF1A1^[1]	Elongation factor 1 alpha	Before activation of zygotic transcription； after hatching； various halibut organs，both in non-injected fish and in mock- and NNV-injected fish	EU561358	F:CCATGGTTGTGGAGTCCTTCTC R:GATGACACCGACAGCCACTGT	NA	60	TaqMan
UbcE^[1]	Ubiquitin-conjugating enzyme E2L 3	Before activation of zygotic transcription	FJ008912	F:GAACTGGAAACCAGCGACAAA R:CGCTCACCAGAGCAATGAGA	NA	60	TaqMan
RPL7^[1]	Ribosomal protein L7	After hatching； various halibut organs, both in non-injected fish and in mock- and NNV-injected fish	FJ008911	F:GAAGGCTCTCGGCAAATATGG R:GCCAACTGTGTAAATCTCATGGAT	NA	60	TaqMan

Name: Sonal Patel
Email: aina-cathrine.oevergaard@imr.no
Institution: Institute of Marine Research, PO Box 1870 Nordnes, N-5817 Bergen, Norway

Cited by 50 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Øvergård A C, Nerland A H, Patel S. Evaluation of potential reference genes for real time RT-PCR studies in Atlantic halibut (Hippoglossus Hippoglossus L.); during development, in tissues of healthy and NNV-injected fish, and in anterior kidney leucocytes[J]. BMC molecular biology, 2010, 11(1): 36.
↑ Skaalsvik TH, Bolla SL, Thornqvist PO, Babiak I.Theriogenology. 2015 Jan 1;83(1):38-47.PMID: 25459032.

@@ Line 58: / Line 58: @@
 |}
-===Molecular Type===
+===Molecular Types===
 * mRNA