Difference between revisions of "Homo sapiens"

From ICG
Jump to navigation Jump to search
 
(30 intermediate revisions by 2 users not shown)
Line 84: Line 84:
 
|align="center"| β-actin
 
|align="center"| β-actin
 
|
 
|
*Visceral adipose samples
+
* Visceral adipose samples (were obtained from 10 patients diagnosed with morbid obesity)
 +
* One of the NAFLD spectrum diseases
 +
* Nine lean patientswith normal liver biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101 '''NM_001101''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101 '''NM_001101''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 96: Line 98:
 
|align="center"| RNA polymerase II
 
|align="center"| RNA polymerase II
 
|
 
|
* Visceral adipose samples
+
* Visceral adipose samples (were obtained from 10 patients diagnosed with morbid obesity)
 +
* One of the NAFLD spectrum diseases
 +
* Nine lean patientswith normal liver biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000937.3 '''NM_000937''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000937.3 '''NM_000937''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 515: Line 519:
 
|align="center"| β-actin
 
|align="center"| β-actin
 
|
 
|
*PMA-induced THP-1 monocyte-to-macrophage differentiation
+
* PMA-induced THP-1 monocyte-to-macrophage differentiation
 +
* THP-1 monocytes were obtained from ATCC (Manassas, Virginia, USA)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 527: Line 532:
 
|align="center"| Ribosomal protein L37a
 
|align="center"| Ribosomal protein L37a
 
|
 
|
*PMA-induced THP-2 monocyte-to-macrophage differentiation
+
* PMA-induced THP-1 monocyte-to-macrophage differentiation
 +
* THP-1 monocytes were obtained from ATCC (Manassas, Virginia, USA)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000998.4 '''NM_000998.4''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000998.4 '''NM_000998.4''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 550: Line 556:
 
*'''Institution''':Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany
 
*'''Institution''':Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany
 
===Citation Statistics===
 
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=3186517875302726277&as_sdt=2005&sciodt=0,5&hl=en '''48'''](Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=3186517875302726277&as_sdt=2005&sciodt=0,5&hl=en '''48'''](Based on Google Scholar [2017-09-01])
  
 
=='''''Ovarian Cancer'''''==
 
=='''''Ovarian Cancer'''''==
Line 568: Line 574:
 
|align="center"| Beta-glucuronidase  
 
|align="center"| Beta-glucuronidase  
 
|
 
|
*Serous ovarian cancer
+
* The human ovarian cancer cell line [https://www.atcc.org/en/Products/Cells_and_Microorganisms/By_Tissue/Ovary/CRL-3128.aspx '''''UACC-1598'''''] & [https://www.atcc.org/Products/All/HTB-77.aspx '''''SKOV3''''']
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000181 '''NM_000181''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000181 '''NM_000181''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 580: Line 586:
 
|align="center"| Peptidylprolyl isomerase A  
 
|align="center"| Peptidylprolyl isomerase A  
 
|
 
|
*Serous ovarian cancer
+
* The human ovarian cancer cell line [https://www.atcc.org/en/Products/Cells_and_Microorganisms/By_Tissue/Ovary/CRL-3128.aspx '''''UACC-1598'''''] & [https://www.atcc.org/Products/All/HTB-77.aspx '''''SKOV3''''']
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 592: Line 598:
 
|align="center"| TATA box binding protein  
 
|align="center"| TATA box binding protein  
 
|
 
|
*Serous ovarian cancer
+
* The human ovarian cancer cell line [https://www.atcc.org/en/Products/Cells_and_Microorganisms/By_Tissue/Ovary/CRL-3128.aspx '''''UACC-1598'''''] & [https://www.atcc.org/Products/All/HTB-77.aspx '''''SKOV3''''']
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194 '''NM_003194''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194 '''NM_003194''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 670: Line 676:
 
|align="center"| Phosphoglycerate kinase 1
 
|align="center"| Phosphoglycerate kinase 1
 
|
 
|
*Ht-29 cells
+
* HT-29 human colonic epithelial cells treated with probiotic and pathogenic bacteria.
 +
 
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000291 '''NM_000291''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000291 '''NM_000291''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 682: Line 689:
 
|align="center"| Ribosomal protein large P0
 
|align="center"| Ribosomal protein large P0
 
|
 
|
*Vk2/E6e7 cells
+
* VK2/E6E7 human vaginal epithelial cells treated with probiotic and pathogenic bacteria.
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001002 '''NM_001002''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001002 '''NM_001002''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 722: Line 729:
 
|align="center"| Signal recognition particle 14 kDa
 
|align="center"| Signal recognition particle 14 kDa
 
|
 
|
*Myocardium
+
* Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
 +
* Non-failed heart tissue
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/827342565 '''NM_003134''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/827342565 '''NM_003134''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 734: Line 742:
 
|align="center"| Translationally-controlled 1
 
|align="center"| Translationally-controlled 1
 
|
 
|
*Myocardium
+
* Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
 +
* Non-failed heart tissue
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/555943846 '''NM_003295''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/555943846 '''NM_003295''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 746: Line 755:
 
|align="center"| Eukaryotic elongation factor 1A1
 
|align="center"| Eukaryotic elongation factor 1A1
 
|
 
|
*Myocardium
+
* Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
 +
* Non-failed heart tissue
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/47419910 '''NM_015905  ''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/47419910 '''NM_015905  ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 765: Line 775:
 
* '''Institution''': Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand
 
* '''Institution''': Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''40''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=15182072179042703374&as_sdt=2005&sciodt=0,5&hl=en '''40'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Breast Cancer'''''==
 
=='''''Breast Cancer'''''==
Line 782: Line 792:
 
|align="center"|  ACTB<ref name="ref14"/>
 
|align="center"|  ACTB<ref name="ref14"/>
 
|align="center"| β-actin
 
|align="center"| β-actin
|
+
|  
*Breast cancer samples
+
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 795: Line 805:
 
|align="center"| 40S ribosomal protein S23  
 
|align="center"| 40S ribosomal protein S23  
 
|
 
|
*Breast cancer samples
+
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001025.4 '''NM_001025''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001025.4 '''NM_001025''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 807: Line 817:
 
|align="center"| E3 ubiquitin-protein ligase HUWE1
 
|align="center"| E3 ubiquitin-protein ligase HUWE1
 
|
 
|
*Breast cancer samples
+
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_031407 '''NM_031407''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_031407 '''NM_031407''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 819: Line 829:
 
|align="center"| Elongation factor 1-alpha 1
 
|align="center"| Elongation factor 1-alpha 1
 
|
 
|
*Breast cancer samples
+
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001402.5 '''NM_001402''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001402.5 '''NM_001402''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 831: Line 841:
 
|align="center"| Splicing factor 3 subunit 1
 
|align="center"| Splicing factor 3 subunit 1
 
|
 
|
*Breast cancer samples
+
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_005877 '''NM_005877''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_005877 '''NM_005877''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 852: Line 862:
 
*'''Institution''':SRC Bioclinicum, Moscow, Russia
 
*'''Institution''':SRC Bioclinicum, Moscow, Russia
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''41''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=12627318641896437747&as_sdt=2005&sciodt=0,5&hl=en '''42'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Prostate Cancer Cells'''''==
 
=='''''Prostate Cancer Cells'''''==
Line 902: Line 912:
 
*'''Institution''': Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil
 
*'''Institution''': Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''16''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=51592710566212111&as_sdt=2005&sciodt=0,5&hl=en '''17'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Stomach Cancer'''''==
 
=='''''Stomach Cancer'''''==
Line 920: Line 930:
 
|align="center"| Beta-2-microglobulin
 
|align="center"| Beta-2-microglobulin
 
|
 
|
* Stomach cancer cell lines;
+
* Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
* All stomach tissues
+
* Five non-stomach cancer cell lines (JIMT1, SK-BR-3, SNU-C5, A549, and U87)
 +
* two normal human cell lines(HDF, HMEC)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 933: Line 944:
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
*Stomach cancer cell lines
+
* Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 945: Line 956:
 
|align="center"| Ribosomal protein L29  
 
|align="center"| Ribosomal protein L29  
 
|
 
|
*All stomach tissues
+
* Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000992 '''NM_000992''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000992 '''NM_000992''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 965: Line 976:
 
*'''Institution''':Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea
 
*'''Institution''':Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''56''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=17738168846180173643&as_sdt=2005&sciodt=0,5&hl=en '''56'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Endometrioid Endometrial Carcinoma Tissues'''''==
 
=='''''Endometrioid Endometrial Carcinoma Tissues'''''==
Line 1,043: Line 1,054:
 
*'''Institution''':''Angelo Nocivelli'' Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,
 
*'''Institution''':''Angelo Nocivelli'' Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''5''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=14772624487340437287&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Epicardial Adipose Tissue'''''==
 
=='''''Epicardial Adipose Tissue'''''==
Line 1,107: Line 1,118:
 
*'''Institution''':Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada
 
*'''Institution''':Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''27''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=6845269495441518075&as_sdt=2005&sciodt=0,5&hl=en '''27'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Cartilage endplate of the lumbar spine'''''==
 
=='''''Cartilage endplate of the lumbar spine'''''==
Line 1,171: Line 1,182:
 
*'''Institution''':Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China
 
*'''Institution''':Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''13''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=409926487862459985&as_sdt=2005&sciodt=0,5&hl=en '''13'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Head and Neck Squamous Cell Carcinoma'''''==
 
=='''''Head and Neck Squamous Cell Carcinoma'''''==
Line 1,190: Line 1,201:
 
|
 
|
 
* Head and neck squamous cell carcinoma
 
* Head and neck squamous cell carcinoma
 +
* All patients were Caucasian and heavy smokers and drinkers
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 1,201: Line 1,213:
 
|align="center"| Succinate dehydrogenase complex, subunit A, flavoprotein
 
|align="center"| Succinate dehydrogenase complex, subunit A, flavoprotein
 
|
 
|
*Head and neck squamous cell carcinoma
+
* Head and neck squamous cell carcinoma
 +
* All patients were Caucasian and heavy smokers and drinkers
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168 '''NM_004168''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168 '''NM_004168''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 1,222: Line 1,235:
 
*'''Institution''':Centre National de la Recherche Scientifique, Montpellier F-34094, France
 
*'''Institution''':Centre National de la Recherche Scientifique, Montpellier F-34094, France
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''39''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=4966999011134229873&as_sdt=2005&sciodt=0,5&hl=en '''39'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Clear Cell Renal Cell Carcinoma'''''==
 
=='''''Clear Cell Renal Cell Carcinoma'''''==
Line 1,240: Line 1,253:
 
|align="center"| Peptidylprolyl isomerase A (cyclophilin A)
 
|align="center"| Peptidylprolyl isomerase A (cyclophilin A)
 
|
 
|
*ccRCC tissues
+
* Clear cell renal cell arcinoma samples & Healthy samples tissues
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 1,252: Line 1,265:
 
|align="center"| Ribosomal protein S13
 
|align="center"| Ribosomal protein S13
 
|
 
|
*ccRCC tissues
+
* Clear cell renal cell arcinoma samples & Healthy samples
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001017.2 '''NM_001017''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001017.2 '''NM_001017''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 1,274: Line 1,287:
 
*'''Institution''':CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium
 
*'''Institution''':CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''20''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=2556083209952067092&as_sdt=2005&sciodt=0,5&hl=en '''23'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Osteoarthritic Articular Cartilage'''''==
 
=='''''Osteoarthritic Articular Cartilage'''''==
Line 1,283: Line 1,296:
 
|align="center"| TBP<ref name="ref22"/>
 
|align="center"| TBP<ref name="ref22"/>
 
|align="center"|TATA-box binding protein ||
 
|align="center"|TATA-box binding protein ||
* Articular cartilage  
+
* Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194 '''NM_003194''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194 '''NM_003194''']  
 
|nowrap style="font-size:9pt"|  
 
|nowrap style="font-size:9pt"|  
Line 1,294: Line 1,307:
 
|align="center"| RPL13A<ref name="ref22"/>
 
|align="center"| RPL13A<ref name="ref22"/>
 
|align="center"| Ribosomal protein S13  ||  
 
|align="center"| Ribosomal protein S13  ||  
* Articular cartilage
+
* Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 1,305: Line 1,318:
 
|align="center"| B2M<ref name="ref22"/>|
 
|align="center"| B2M<ref name="ref22"/>|
 
|align="center"|Beta-2-microglobulin  ||  
 
|align="center"|Beta-2-microglobulin  ||  
* Articular cartilage
+
* Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 1,327: Line 1,340:
 
*'''Institution''': Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain
 
*'''Institution''': Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''73''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=15105537215980678386&as_sdt=2005&sciodt=0,5&hl=en '''75'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Hepatocellular Carcinoma'''''==
 
=='''''Hepatocellular Carcinoma'''''==
Line 1,405: Line 1,418:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''92''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=12922105542327270557&as_sdt=2005&sciodt=0,5&hl=en '''92'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==

Latest revision as of 13:47, 6 September 2017

Contents

Description

Homo sapiens.png
  • Homo sapiens (Latin: "wise man") is the binomial nomenclature for the only extant human species. Homo is the human genus, which also includes Neanderthals and many other extinct species of hominin. H. sapiens is the only surviving species of the genus Homo. Modern humans are the subspecies Homo sapiens, which differentiates them from what has been argued to be their direct ancestor, Homo sapiens idaltu (Modified from Wikipedia).
  • Common Name: Human being, Wise man
  • NCBI Taxonomy

U87MG Cell Line

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
DDX5[1] RNA helicase
  • Using Interferons in U87MG Cell Line
NM_004396
  • F:TAGAGGTCACAACTGCCCGAAG
  • R:GGCCATCCCTGAGCTTGAATAG
125 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Using Interferons in U87MG Cell Line
NM_002046
  • F:CCATGGGTGGAATCATATTGGA
  • R:TCAACGGATTTGGTCGTATTGG
138 60 SYBR
HMBS[1] Hydroxymethylbilane synthase
  • Using Interferons in U87MG Cell Line
NM_000190
  • F:GGAATGTTACGAGCAGTGATGC
  • R:CCTGACTGGAGGAGTCTGGAGT
150 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Iraldo Bello
  • Email:dania.vazquez@cigb.edu.cu
  • Institution:Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

Visceral Adipose Samples

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[2] β-actin
  • Visceral adipose samples (were obtained from 10 patients diagnosed with morbid obesity)
  • One of the NAFLD spectrum diseases
  • Nine lean patientswith normal liver biopsies
NM_001101
  • F:CTCTTCCAGCCTTCCTTCCT
  • R:AGCACTGTGTTGGCGTACAG
NA 55 EvaGreen
RPII[2] RNA polymerase II
  • Visceral adipose samples (were obtained from 10 patients diagnosed with morbid obesity)
  • One of the NAFLD spectrum diseases
  • Nine lean patientswith normal liver biopsies
NM_000937
  • F:CTTCACGGTGCTGGGCATT
  • R:GTGCGGCTGCTTCCATAA
NA 60 EvaGreen

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ancha Baranova
  • Email: abaranov@gmu.edu
  • Institution:Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA

Citation Statistics

Cited by 72 (Based on Google Scholar [2017-09-01])

Lung Cancer

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[3] β-actin NM_000937
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TACTCCTGCTTGCTGATCCA
111 58 SYBR
PPIA[3] Peptidylprolyl isomerase A, cydophilin A, romatase A NM_021130
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TGCTGGTCTTGCCATTCCT
179 58 SYBR
PGK1[3] Phosphoglycerate kinase-1 NM_000291
  • F:GCCACTTGCTGTGCCAAATG
  • R:CCCAGGAAGGACTTTACCTT
102 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:GUIZHEN ZHANG
  • Email:zhanguizhenjlu@163.com
  • Institution:Department of Central Laboratory, Second Hospital, Jilin University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

Mesenchymal Stromal Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TBP[4] TATA-binding protein
  • Mesenchymal stromal cells from the bone marrow
  • Adipose-derived stromal cells
NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
NA 60 SYBR
YWHAZ[4] Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Mesenchymal stromal cells from the bone marrow
  • Adipose-derived stromal cells
NM_001135702
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Mandana Haack
  • Email:Mandana.Haack-Soerensen@regionh.dk
  • Institution:Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Glioma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[5] Glyceraldehyde-3-phosphate dehydrogenase
  • Glioma of different grades (World Health Organization grades II-IV).
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
  • Tumor tissues and normal samples were from patients undergoing surgery.
NM_002046
  • F:TCGCCAGCCGAGCCACATC
  • R:CGTTCTCAGCCTTGACGGTGC
222 55 SYBR
RPL13A[5] Ribosomal protein L13a
  • Glioma of different grades (World Health Organization grades II-IV).
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
  • Tumor tissues and normal samples were from patients undergoing surgery.
NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R: TTGAGGACCTCTGTGTATTTGTCAA
126 55 SYBR
CYC1[5] Cytochrome c-1
  • Glioma of different grades (World Health Organization grades II-IV).
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
  • Tumor tissues and normal samples were from patients undergoing surgery.
NM_001916
  • F:GAGGTGGAGGTTCAAGACGG
  • R:TAGCTCGCACGATGTAGCTG
160 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Susanne Grube
  • Email:susanne.grube@med.uni-jena.de
  • Institution:Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

Metastatic Clear Cell Renal Cell Carcinoma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL13[6] Ribosomal protein L13
  • 35 primary tumor nonmetastatic versus 35 mccRCC samples and matched metastasized T/C/M samples
NM_000977
  • F:TTCCGCTCGGCTGTTTTCCTG
  • R:GGGCCTTACGTCTGCGGATCTTA
164 59 SYBR
GUSB[6] Glucuronidase, beta
  • 152 samples and in paired Tand C(n=140) kidney samples
NM_000181
  • F:ATGCAGGTGATGGAAGAAGTGGTG
  • R:AGAGTTGCTCACAAAGGTCACAGG
177 59 SYBR
RPLP0[6] Ribosomal protein, large, P0
  • Matchedtumor-control-metastasized ccRCC samples
NM_001002
  • F:TAAACCCTGCGTGGCAATCCCTG
  • R:TGAACACAAAGCCCACATTCCCC
307 58.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Zbigniew Kmiec
  • Email: pwierzb@gumed.edu.pl
  • Institution:Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. Dębinki 1, PL 80-211 Gdańsk, Poland e-mail: pwierzb@gumed.edu.pl

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Differentiating Human Embryonic Stem Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
B2M[7] Beta-2-microglobulin
  • During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.
NM_004048
  • F:TGCTGTCTCCATGTTTGATGTATCT
  • R:TCTCTGCTCCCCACCTCTAAGT
86 60 SYBR
RPL13A[7] Ribosomal protein L13A
  • During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.
NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R:TTGAGGACCTCTGTGTATTTGTCAA
126 60 SYBR
AluSq[7] Alu repeats, subfamily Sq
  • During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.
NA
  • F:CATGGTGAAACCCCGTCTCTA
  • R:GCCTCAGCCTCCCGAGTAG
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Dieter Deforce
  • Email:Dieter.Deforce@UGent.be
  • Institution:Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium

Citation Statistics

Cited by 11(Based on Google Scholar [2017-09-01])

Umbilical Vein Endothelial Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
B2M[8] Beta-2-microglobulin
  • Umbilical vein endothelial cells on substrates with different stiffness
NM_004048
  • F:CACCCCCACTGAAAAAGATGAG
  • R:CCTCCATGATGCTGCTTACATG
106 59 SYBR
HPRT-1[8] Hypoxanthine phosphoribosyl-transferase 1
  • Umbilical vein endothelial cells on substrates with different stiffness
NM_000194
  • F:GACCAGTCAACAGGGGACAT
  • R:AACACTTCGTGGGGTCCTTTTC
195 59 SYBR
YWHAZ[8] Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide
  • Umbilical vein endothelial cells on substrates with different stiffness
NM_003406
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
94 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Hong Zhou
  • Email:zhouhtt1966@163.com
  • Institution:Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

THP-1 Monocyte Differentiation Into Macrophages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[9] β-actin
  • PMA-induced THP-1 monocyte-to-macrophage differentiation
  • THP-1 monocytes were obtained from ATCC (Manassas, Virginia, USA)
NM_001101
  • F:ATTGCCGACAGGATGCAGAA
  • R:GCTGATCCACATCTGCTGGAA
150 60 SYBR
RPL37A[9] Ribosomal protein L37a
  • PMA-induced THP-1 monocyte-to-macrophage differentiation
  • THP-1 monocytes were obtained from ATCC (Manassas, Virginia, USA)
NM_000998.4
  • F:ATTGAAATCAGCCAGCACGC
  • R:AGGAACCACAGTGCCAGATCC
94 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Stefan Lorkowski
  • Email:stefan.lorkowski@uni-jena.de
  • Institution:Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany

Citation Statistics

Cited by 48(Based on Google Scholar [2017-09-01])

Ovarian Cancer

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GUSB[10] Beta-glucuronidase NM_000181
  • F:AGCCAGTTCCTCATCAATGG
  • R:GGTAGTGGCTGGTACGGAAA
160 60 or 63 SYBR
PPIA[10] Peptidylprolyl isomerase A NM_021130
  • F:AGACAAGGTCCCAAAGAC
  • R:ACCACCCTGACACATAAA
118 61 or 63 SYBR
TBP[10] TATA box binding protein NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
132 62 or 63 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Xing Xie
  • Email:xiex@mail.hz.zj.cn
  • Institution:Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2,Hangzhou 310006, China

Citation Statistics

Cited by 81 (Based on Google Scholar [2017-09-01])

Normal Thyroid & Goiter Tissue

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[11] β-actin
  • Normal thyroid and goiter tissues
NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAATGCA
140 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Tania Weber Furlanetto
  • Email:taniafurlanetto@gmail.com
  • Institution:UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

Colonic and Vaginal Epithelial Cell Lines

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PGK1[12] Phosphoglycerate kinase 1
  • HT-29 human colonic epithelial cells treated with probiotic and pathogenic bacteria.
NM_000291
  • F:GAGATGATTATTGGTGGTGGAA
  • R:AGTCAACAGGCAAGGTAATC
NA 60 SYBR
RPLP0[12] Ribosomal protein large P0
  • VK2/E6E7 human vaginal epithelial cells treated with probiotic and pathogenic bacteria.
NM_001002
  • F:ACAATGGCAGCATCTACA
  • R:GTAATCCGTCTCCACAGA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Nikolai Scherbak
  • Email:nikolai.scherbak@oru.se
  • Institution:School of Science and Technology, Sweden

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

Myocardium

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SRP14[13] Signal recognition particle 14 kDa
  • Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
  • Non-failed heart tissue
NM_003134
  • F:CAGATGGCTTATTCAAACCTCCT
  • R:ATGCCCTTTACTGTGCTGCT
181 60~61 SYBR
TPT1[13] Translationally-controlled 1
  • Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
  • Non-failed heart tissue
NM_003295
  • F:AAATGTTAACAAATGTGGCAATTAT
  • R:AACAATGCCTCCACTCCAAA
164 58~61 SYBR
EEF1A1[13] Eukaryotic elongation factor 1A1
  • Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
  • Non-failed heart tissue
NM_015905
  • F:CTTTGGGTCGCTTTGCTGTT
  • R:CCGTTCTTCCACCACTGATT
183 60~63 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Vicky A Cameron
  • Email:vicky.cameron@otago.ac.nz
  • Institution: Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand

Citation Statistics

Cited by 40 (Based on Google Scholar [2017-09-01])

Breast Cancer

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[14] β-actin
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAACGCA
140 64 SYBR
RPS23[14] 40S ribosomal protein S23
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
NM_001025
  • F:CGGTGCTTCTCTCTTTCGCT
  • R:ATGCCACTTCTGGTCTCGT
110 64 SYBR
HUWE1[14] E3 ubiquitin-protein ligase HUWE1
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
NM_031407
  • F:CAGAGTTGGACAGAGTGAAA
  • R:TACACAGAGAGAGGAGGACA
137 64 SYBR
EEF1A1[14] Elongation factor 1-alpha 1
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
NM_001402
  • F:TGAAAACTACCCCTAAAAGCCA
  • R: TATCCAAGACCCAGGCATACT
208 64 SYBR
SF3A1[14] Splicing factor 3 subunit 1
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
NM_005877
  • F:AAGGGTCCAGTGTCCATCAAAGT
  • R:GCCATGTTGTAGTAAGCCAGTGAG
224 64 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Alexander G Tonevitsky
  • Email:d.maltseva@bioclinicum.com
  • Institution:SRC Bioclinicum, Moscow, Russia

Citation Statistics

Cited by 42 (Based on Google Scholar [2017-09-01])

Prostate Cancer Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[15] Glyceraldehyde-3-phosphate dehydrogenase
  • Prostate cancer cells
NM_002046
  • F:CTTTGTCAAGCTCATTTCCTGG
  • R:TCTTCCTCTTGTGCTCTTGC
133 NA SYBR
SDHA[15] Succinate dehydrogenase complex, subunit A, flavoprotein(Fp)
  • Prostate cancer cells
NM_004168
  • F:TGGTTGTCTTTGGTCGGG
  • R:GCGTTTGGTTTAATTGGAGGG
85 NA SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Gisele Branchini
  • Email:giseleb@ufcspa.edu.br
  • Institution: Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

Stomach Cancer

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
B2M[16] Beta-2-microglobulin
  • Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
  • Five non-stomach cancer cell lines (JIMT1, SK-BR-3, SNU-C5, A549, and U87)
  • two normal human cell lines(HDF, HMEC)
NM_004048
  • F:ACTGAATTCACCCCCACTGA
  • R:CCTCCATGATGCTGCTTACA
114 58 SYBR
GAPDH[16] Glyceraldehyde-3-phosphate dehydrogenase
  • Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
NM_002046
  • F:TGCACCACCAACTGCTTA
  • R:GGATGCAGGGATGATGTTC
177 58 SYBR
RPL29[16] Ribosomal protein L29
  • Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
NM_000992
  • F:GGCGTTGTTGACCCTATTTC
  • R:GTGTGTGGTGTGGTTCTTGG
120 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Sung-Ho Goh
  • Email:andrea@ncc.re.kr
  • Institution:Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea

Citation Statistics

Cited by 56 (Based on Google Scholar [2017-09-01])

Endometrioid Endometrial Carcinoma Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PPIA[17] Peptidylprolyl isomerase A (Cyclophilin A)
  • Endometrial tumor samples at different tumor degrees
  • Study groups regardless of sample type
  • Endometrioid endometrial cancer samples
NM_021130
  • F: GAGGAAAACCGTGTACTATTAGC
  • R: GGGACCTTGTCTGCAAAC
113 60 SYBR
HPRT1[17] Hypoxanthine phosphoribosyltransferase 1
  • Study groups regardless of sample type
  • Endometrioid endometrial cancer samples
NM_000194
  • F: CTGGAAAGAATGTCTTGATTGTG
  • R: GACCTTGACCATCTTTGGATTA
104 60 SYBR
GAPDH[17] Glyceraldehyde-3-phosphate dehydrogenase
  • Endometrioid endometrial cancer samples
NM_002046
  • F: CCCTTCATTGACCTCAACTACATG
  • R: TGGGATTTCCATTGATGACAAGC
115 60 SYBR
H3F3A[17] H3 histone, family 3A
  • Endometrioid endometrial cancer samples
NM_002107
  • F: TGCTCAGGACTTTAAAACAGA
  • R: CACAGGTTGGTGTCTTCAA
108 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Eliana Bignotti
  • Email:cromani76@gmail.com
  • Institution:Angelo Nocivelli Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

Epicardial Adipose Tissue

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CYCA[18] Peptidylprolyl isomerase A
  • Human epicardial adipose tissue
NM_021130
  • F:ATCCTAGAGGTGGCGGATTT
  • R:CACTCAGGTCTGAGCCACAA
NA NA SYBR
GAPDH[18] Glycerladehyde 3-phosphate dehydrogenase
  • Human epicardial adipose tissue
NM_002046
  • F:ATGTTCGTCATGGGTGTGAA
  • R:GGTGCTAAGCAGTTGGTGGT
NA NA SYBR
RPL27[18] Ribosomal protein L27
  • Human epicardial adipose tissue
NM_000988
  • F: GTGAAAGTGTATAACTACAATCACC
  • R: TCAAACTTGACCTTGGCCT
NA NA SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Denis Richard
  • Email:Denis.Richard@criucpq.ulaval.ca
  • Institution:Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada

Citation Statistics

Cited by 27 (Based on Google Scholar [2017-09-01])

Cartilage endplate of the lumbar spine

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SDHA[19] Succinate dehydrogenase complex, subunit A
  • Cartilage endplate of the lumbar Spine
NM_004168
  • F:AGACCTAAAGCACCTGAAGACG
  • R:ATCAATCCGCACCTTGTAGTCT
175 60 SYBR
B2M[19] Beta-2-microglobulin
  • Cartilage endplate of the lumbar Spine
NM_004048
  • F:ATCCATCCGACATTGAAGTTG
  • R:GGCAGGCATACTCATCTTTTTC
150 60 SYBR
LDHA[19] Lactate dehydrogenase A
  • Cartilage endplate of the lumbar Spine
NM_005566
  • F:GCCTGTATGGAGTGGAATGAA
  • R:CCAGGATGTGTAGCCTTTGAG
157 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Shun-Wu Fan
  • Email:zzj-0708@163.com
  • Institution:Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

Head and Neck Squamous Cell Carcinoma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[20] Glyceraldehyde-3-phosphate dehydrogenase
  • Head and neck squamous cell carcinoma
  • All patients were Caucasian and heavy smokers and drinkers
NM_002046
  • F:TGAACGGGAAGCTCACTGG
  • R:TCCACCACCCTGTTGCTGTA
307 60 SYBR
SDHA[20] Succinate dehydrogenase complex, subunit A, flavoprotein
  • Head and neck squamous cell carcinoma
  • All patients were Caucasian and heavy smokers and drinkers
NM_004168
  • F:AGCAAGCTCTATGGAGACCT
  • R:TAATCGTACTCATCAATCCG
200 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Jean-Paul Brouillet
  • Email:jpbrouillet@gmail.com
  • Institution:Centre National de la Recherche Scientifique, Montpellier F-34094, France

Citation Statistics

Cited by 39 (Based on Google Scholar [2017-09-01])

Clear Cell Renal Cell Carcinoma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PPIA[21] Peptidylprolyl isomerase A (cyclophilin A)
  • Clear cell renal cell arcinoma samples & Healthy samples tissues
NM_021130
  • F:ACCGCCGAGGAAAACCGTGTA
  • R:TGCTGTCTTTGGGACCTTGTCTGC
129 60 SYBR
RPS13[21] Ribosomal protein S13
  • Clear cell renal cell arcinoma samples & Healthy samples
NM_001017
  • F:TCGGCTTTACCCTATCGACGCAG
  • R:ACGTACTTGTGCAACACCATGTGA
153 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Christophe E Pierreux
  • Email:christophe.pierreux@uclouvain.be
  • Institution:CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

Osteoarthritic Articular Cartilage

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
PCR Size (bp) Tm Detection
TBP[22] TATA-box binding protein
  • Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
NM_003194
  • F: TGCACAGGAGCCAAGAGTGAA
  • R: CACATCACAGCTCCCCACCA
132 56 ℃  SYBR
RPL13A[22] Ribosomal protein S13
  • Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
NM_012423
  • F: AAAAAGCGGATGGTGGTTC
  • R: CTTCCGGTAGTGGATCTTGG
168 56 ℃  SYBR
B2M[22]| Beta-2-microglobulin
  • Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
NM_004048
  • F: ATGAGTATGCCTGCCGTGTGA
  • R: GGCATCTTCAAACCTCCATG
101 56 ℃  SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Antonio Gonzalez
  • Email: Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
  • Institution: Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain

Citation Statistics

Cited by 75 (Based on Google Scholar [2017-09-01])

Hepatocellular Carcinoma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HMBS[23] Hydroxymethylbilane synthase
  • Universial reference gene for gene expression studies in HCC
NM_000190.3
  • F: TGCAACGGCGGAAGAAAA
  • R: ACGAGGCTTTCAATGTTGCC
113 56.4 SYBR
GAPDH[23] Glyceraldehyde-3-phosphate dehydrogenase
  • Tumoral and adjacent non-tumoral tissues derived from patients with HCC
  • Liver cancer cell lines: Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
NM_012423
  • F: TGCACCACCAACTGCTTAGC
  • R: GGCATGGACTGTGGTCATGAG
87 56.4 SYBR
UBC[23] Ubiquitin C
  • Tumor tissues
NM_021009.3
  • F: CGGTGAACGCCGATGATTAT
  • R: ATCTGCATTGTCAAGTGACGA
124 56.4 SYBR
SDHA[23] Succinate dehydrogenase complex, subunit A
  • Liver cancer cell lines: Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
NM_004168.2
  • F: TGGGAACAAGAGGGC ATCTG
  • R: CCACCACTGCATCAAATTCATG
86 56.4 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Susanne Beckebaum
  • Email: susanne.beckebaum@uni-due.de
  • Institution: Department of Gastroenterology and Hepatology, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.

Citation Statistics

Cited by 92 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Vázquez-Blomquist D, Fernández J R, Miranda J, et al. Selection of reference genes for use in quantitative reverse transcription PCR assays when using interferons in U87MG[J]. Molecular biology reports, 2012, 39(12): 11167-11175.
  2. 2.0 2.1 Mehta R, Birerdinc A, Hossain N, et al. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples[J]. BMC Molecular Biology, 2010, 11(1): 39.
  3. 3.0 3.1 3.2 Ali H, Du Z, Li X, et al. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro[J]. Molecular medicine reports, 2015, 11(5): 3767-3773.
  4. 4.0 4.1 Tratwal J, Follin B, Ekblond A, Kastrup J, Haack-Sørensen M. Identification of a common reference gene pair for qPCR in human mesenchymal stromal cells from different tissue sources treated with VEGF. BMC Mol Biol. 2014 May 28;15:11. doi: 10.1186/1471-2199-15-11. PubMed PMID: 24885696; PubMed Central PMCID: PMC4045907.
  5. 5.0 5.1 5.2 Grube S, Göttig T, Freitag D, Ewald C, Kalff R, Walter J. Selection of suitable reference genes for expression analysis in human glioma using RT-qPCR. J Neurooncol. 2015 May;123(1):35-42. doi: 10.1007/s11060-015-1772-7. Epub 2015 Apr 11. PubMed PMID: 25862007.
  6. 6.0 6.1 6.2 Wierzbicki P M, Klacz J, Rybarczyk A, et al. Identification of a suitable qPCR reference gene in metastatic clear cell renal cell carcinoma[J]. Tumor Biology, 2014, 35(12): 12473-12487.
  7. 7.0 7.1 7.2 Vossaert L, O’Leary T, Van Neste C, et al. Reference loci for RT-qPCR analysis of differentiating human embryonic stem cells[J]. BMC molecular biology, 2013, 14(1): 21.
  8. 8.0 8.1 8.2 Chen G, Zhao L, Feng J, et al. Validation of reliable reference genes for real-time PCR in human umbilical vein endothelial cells on substrates with different stiffness[J]. PLoS One, 2013, 8(6): e67360.
  9. 9.0 9.1 Maeß M B, Sendelbach S, Lorkowski S. Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages[J]. BMC molecular biology, 2010, 11(1): 90.
  10. 10.0 10.1 10.2 Li Y L, Ye F, Hu Y, et al. Identification of suitable reference genes for gene expression studies of human serous ovarian cancer by real-time polymerase chain reaction[J]. Analytical biochemistry, 2009, 394(1): 110-116.
  11. Weber R, Bertoni A P S, Bessestil L W, et al. Validation of reference genes for normalization gene expression in reverse transcription quantitative PCR in human normal thyroid and goiter tissue[J]. BioMed research international, 2014, 2014.
  12. 12.0 12.1 Jacobsen A V, Yemaneab B T, Jass J, et al. Reference gene selection for qPCR Is dependent on cell type rather than treatment in colonic and vaginal human epithelial cell lines[J]. PloS one, 2014, 9(12): e115592.
  13. 13.0 13.1 13.2 Pilbrow A P, Ellmers L J, Black M A, et al. Genomic selection of reference genes for real-time PCR in human myocardium[J]. BMC medical genomics, 2008, 1(1): 64.
  14. 14.0 14.1 14.2 14.3 14.4 Maltseva D V, Khaustova N A, Fedotov N N, et al. High-throughput identification of reference genes for research and clinical RT-qPCR analysis of breast cancer samples[J]. Journal of clinical bioinformatics, 2013, 3(1): 13.
  15. 15.0 15.1 Souza A F D, Brum I S, Neto B S, et al. Reference gene for primary culture of prostate cancer cells[J]. Molecular biology reports, 2013, 40(4): 2955-2962.
  16. 16.0 16.1 16.2 Rho H W, Lee B C, Choi E S, et al. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR[J]. BMC cancer, 2010, 10(1): 240.
  17. 17.0 17.1 17.2 17.3 Romani C, Calza S, Todeschini P, et al. Identification of optimal reference genes for gene expression normalization in a wide cohort of endometrioid endometrial carcinoma tissues[J]. PloS one, 2014, 9(12): e113781.
  18. 18.0 18.1 18.2 Chechi K, Gelinas Y, Mathieu P, et al. Validation of reference genes for the relative quantification of gene expression in human epicardial adipose tissue[J]. PloS one, 2012, 7(4): e32265.
  19. 19.0 19.1 19.2 Zhou Z J, Zhang J F, Xia P, et al. Selection of suitable reference genes for normalization of quantitative real-time polymerase chain reaction in human cartilage endplate of the lumbar spine[J]. PLoS One, 2014, 9(2): e88892.
  20. 20.0 20.1 Lallemant B, Evrard A, Combescure C, et al. Reference gene selection for head and neck squamous cell carcinoma gene expression studies[J]. BMC Molecular Biology, 2009, 10(1): 78.
  21. 21.0 21.1 Dupasquier S, Delmarcelle A S, Marbaix E, et al. Validation of housekeeping gene and impact on normalized gene expression in clear cell renal cell carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression[J]. BMC molecular biology, 2014, 15(1): 9.
  22. 22.0 22.1 22.2 Pombo-Suarez M, Calaza M, Gomez-Reino J J, et al. Reference genes for normalization of gene expression studies in human osteoarthritic articular cartilage[J]. BMC molecular biology, 2008, 9(1): 17.
  23. 23.0 23.1 23.2 23.3 Cicinnati V R, Shen Q, Sotiropoulos G C, et al. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR[J]. BMC cancer, 2008, 8(1): 350.

Categories