Difference between revisions of "Homo sapiens"

From ICG
Jump to navigation Jump to search
(275 intermediate revisions by 7 users not shown)
Line 1: Line 1:
=='''Bisceral Adipose Samples'''==
===Reference Genes===
[[File:Homo sapiens.png|right|200px|link=Homo sapiens]]
{|class="wikitable sortable" style="font-size:10pt; width:100%"
* '''''Homo sapiens''''' (Latin: "wise man") is the binomial nomenclature for the only extant human species. ''Homo'' is the human genus, which also includes Neanderthals and many other extinct species of hominin. ''H. sapiens'' is the only surviving species of the genus ''Homo''. Modern humans are the subspecies ''Homo sapiens'', which differentiates them from what has been argued to be their direct ancestor, ''Homo sapiens idaltu'' [https://en.wikipedia.org/wiki/Homo_sapiens (Modified from Wikipedia)].
* <font color=blue>'''Common Name:'''</font> '''Human being''', '''Wise man'''
! Gene Symbol 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606 <font color=blue>'''NCBI Taxonomy'''</font>]
! Gene Name
! style="width=25% font-size:9pt "|Application Scope
! Accession Number
! Primer
! Size [bp]
! Tm [℃]
! Detection
|align="center"| ACTB<ref name="ref1"/>
|align="center"| β-Actin
visceral adipose samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000937.3 '''NM_000937''']
|nowrap style="font-size:9pt"|
|align="center"| NA
|align="center"| 55
|align="center"| EvaGreen
|align="center"| RPII <ref name="ref1"/>
|align="center"| RNA polymerase II
visceral adipose samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.2 '''NM_001102''']
|nowrap style="font-size:9pt"|
|align="center"| NA
|align="center"| 60
|align="center"| EvaGreen
===Moleculer Types===
===Evaluation Methods===
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
*'''Name''': Ancha Baranova
*'''Email''': abaranov@gmu.edu
*'''Institution''':Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA
===Citation Statistics===
Cited by '''73''' (Based on Google Scholar [2017-06-01])
=='''Using Interferons in U87MG'''==
=='''''U87MG Cell Line'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 58: Line 13:
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
! Detection
! Detection
|align="center"| DDX5<ref name="ref2"/>
|align="center"| DDX5<ref name="ref1"/>
|align="center"| RNA helicase
|align="center"| RNA helicase
*Using Interferons in U87MG Cell Line
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004396 '''NM_004396''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004396 '''NM_004396''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 75: Line 30:
|align="center"| SYBR
|align="center"| SYBR
|align="center"| GAPDH<ref name="ref2"/>
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
*Using Interferons in U87MG Cell Line
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 87: Line 42:
|align="center"| SYBR
|align="center"| SYBR
|align="center"|  HMBS<ref name="ref2"/>
|align="center"|  HMBS<ref name="ref1"/>
|align="center"| hydroxymethylbilane synthase
|align="center"| Hydroxymethylbilane synthase
*Using Interferons in U87MG Cell Line
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000190 '''NM_000190''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000190 '''NM_000190''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 100: Line 55:
===Moleculer Types===
===Molecular Types===
* mRNA
* mRNA
Line 111: Line 66:
*'''Institution''':Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba
*'''Institution''':Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba
===Citation Statistics===
===Citation Statistics===
Cited by '''7''' (Based on Google Scholar [2017-06-01])
Cited by [https://scholar.google.com/scholar?cites=9418364999959879926&as_sdt=2005&sciodt=0,5&hl=en '''8'''] (Based on Google Scholar [2017-09-01])
=='''Lung Cancer'''==
=='''''Visceral Adipose Samples'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 121: Line 76:
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]
! Tm [℃]
! Detection
|align="center"| ACTB<ref name="ref2"/>
|align="center"| β-actin
* Visceral adipose samples (were obtained from 10 patients diagnosed with morbid obesity)
* One of the NAFLD spectrum diseases
* Nine lean patientswith normal liver biopsies
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101 '''NM_001101''']
|nowrap style="font-size:9pt"|
|align="center"| NA
|align="center"| 55
|align="center"| EvaGreen
|align="center"| RPII<ref name="ref2"/>
|align="center"| RNA polymerase II
* Visceral adipose samples (were obtained from 10 patients diagnosed with morbid obesity)
* One of the NAFLD spectrum diseases
* Nine lean patientswith normal liver biopsies
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000937.3 '''NM_000937''']
|nowrap style="font-size:9pt"|
|align="center"| NA
|align="center"| 60
|align="center"| EvaGreen
===Molecular Types===
===Evaluation Methods===
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
*'''Name''': Ancha Baranova
*'''Email''': abaranov@gmu.edu
*'''Institution''':Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=5037278134639518123&as_sdt=2005&sciodt=0,5&hl=en '''72'''] (Based on  Google Scholar [2017-09-01])
=='''''Lung Cancer'''''==
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene Symbol 
! Gene Name
! style="width=25% font-size:9pt "|Application Scope
! Accession Number
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 127: Line 137:
|align="center"| ACTB<ref name="ref3"/>
|align="center"| ACTB<ref name="ref3"/>
|align="center"| β -actin
|align="center"| β-actin
lung cancer cell lines
*Lung cancer cell lines ([https://en.wikipedia.org/wiki/A549_cell '''''A549'''''], [http://web.expasy.org/cellosaurus/CVCL_1562 ''''' NCI-H446'''''] and  [http://web.expasy.org/cellosaurus/CVCL_0459 '''''NCI-H460'''''])
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000937.3 '''NM_000937''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000937.3 '''NM_000937''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 141: Line 151:
|align="center"| Peptidylprolyl isomerase A, cydophilin A, romatase A  
|align="center"| Peptidylprolyl isomerase A, cydophilin A, romatase A  
lung cancer cell lines
*Lung cancer cell lines ([https://en.wikipedia.org/wiki/A549_cell '''''A549'''''], [http://web.expasy.org/cellosaurus/CVCL_1562 ''''' NCI-H446'''''] and  [http://web.expasy.org/cellosaurus/CVCL_0459 '''''NCI-H460'''''])
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 153: Line 163:
|align="center"| Phosphoglycerate kinase-1  
|align="center"| Phosphoglycerate kinase-1  
lung cancer cell lines
*Lung cancer cell lines ([https://en.wikipedia.org/wiki/A549_cell '''''A549'''''], [http://web.expasy.org/cellosaurus/CVCL_1562 ''''' NCI-H446'''''] and  [http://web.expasy.org/cellosaurus/CVCL_0459 '''''NCI-H460'''''])
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000291.3 '''NM_000291''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000291.3 '''NM_000291''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 163: Line 173:
===Moleculer Types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 173: Line 183:
*'''Institution''':Department of  Central  Laboratory,  Second  Hospital,  Jilin  University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China
*'''Institution''':Department of  Central  Laboratory,  Second  Hospital,  Jilin  University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China
===Citation Statistics===
===Citation Statistics===  
Cited by '''7''' (Based on Google Scholar [2017-06-01])
Cited by [https://scholar.google.com/scholar?cites=12562068675571957851&as_sdt=2005&sciodt=0,5&hl=en '''7'''] (Based on Google Scholar [2017-09-01])
=='''Mesenchymal Stromal Cells'''==
=='''''Mesenchymal Stromal Cells'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene Symbol   
! Gene Symbol   
! Gene Name  
! Gene Name  
! style="width=25% font-size:9pt "|Application Scope  
! style="width=35% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 192: Line 202:
|align="center"| TATA-binding protein
|align="center"| TATA-binding protein
*Human mesenchymal stromal cells from the bone marrow;
*Mesenchymal stromal cells from the bone marrow
*adipose-derived stromal cells
*Adipose-derived stromal cells
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194.4 '''NM_003194''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194.4 '''NM_003194''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 203: Line 213:
|align="center"|  YWHAZ<ref name="ref4"/>
|align="center"|  YWHAZ<ref name="ref4"/>
|align="center"| tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
|align="center"| Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
*Human mesenchymal stromal cells from the bone marrow;
*Mesenchymal stromal cells from the bone marrow
*adipose-derived stromal cells
*Adipose-derived stromal cells
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001135702.1 '''NM_001135702''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001135702.1 '''NM_001135702''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 216: Line 226:
===Moleculer Types===
===Molecular Types===
* mRNA
* mRNA
Line 227: Line 237:
*'''Institution''':Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark
*'''Institution''':Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark
===Citation Statistics===
===Citation Statistics===
Cited by '''10''' (Based on Google Scholar [2017-06-01])
Cited by [https://scholar.google.com/scholar?cites=3727512229077622488&as_sdt=2005&sciodt=0,5&hl=en '''10''' ] (Based on Google Scholar [2017-09-01])
=='''Glioma '''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 237: Line 247:
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 245: Line 255:
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
* glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
* Glioma of different grades (World Health Organization grades II-IV).
* Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
* Tumor tissues and normal samples were from patients undergoing surgery.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 257: Line 269:
|align="center"| Ribosomal protein L13a  
|align="center"| Ribosomal protein L13a  
* glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
* Glioma of different grades (World Health Organization grades II-IV).
* Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
* Tumor tissues and normal samples were from patients undergoing surgery.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 269: Line 283:
|align="center"| Cytochrome c-1
|align="center"| Cytochrome c-1
* glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
* Glioma of different grades (World Health Organization grades II-IV).
* Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
* Tumor tissues and normal samples were from patients undergoing surgery.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001916 '''NM_001916''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001916 '''NM_001916''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 279: Line 295:
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 289: Line 306:
*'''Institution''':Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany
*'''Institution''':Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=8142542069386388098&as_sdt=2005&sciodt=0,5&hl=en '''6'''] (Based on Google Scholar [2017-09-01])
=='''Metastatic Clear Cell Renal Cell Carcinoma'''==
=='''''Metastatic Clear Cell Renal Cell Carcinoma'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 313: Line 332:
|align="center"| 164
|align="center"| 164
|align="center"| 59
|align="center"| 59
|align="center"| Sybr
|align="center"| SYBR
|align="center"|  GUSB<ref name="ref6"/>
|align="center"|  GUSB<ref name="ref6"/>
|align="center"| Glucuronidase, beta
|align="center"| Glucuronidase, beta
* total 152 samples and in paired Tand C(n=140) kidney samples
* 152 samples and in paired Tand C(n=140) kidney samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000181.3 '''NM_000181''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000181.3 '''NM_000181''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 325: Line 344:
|align="center"| 177
|align="center"| 177
|align="center"| 59
|align="center"| 59
|align="center"| Sybr
|align="center"| SYBR
|align="center"| RPLP0<ref name="ref6"/>
|align="center"| RPLP0<ref name="ref6"/>
|align="center"| Ribosomal protein, large, P0
|align="center"| Ribosomal protein, large, P0
* matchedtumor-control-metastasized ccRCC samples
* Matchedtumor-control-metastasized ccRCC samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001002.3 '''NM_001002''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001002.3 '''NM_001002''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 337: Line 356:
|align="center"| 307
|align="center"| 307
|align="center"| 58.5
|align="center"| 58.5
|align="center"| Sybr
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===
===Evaluation Methods===
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 350: Line 370:
*'''Name''':Zbigniew Kmiec
*'''Name''':Zbigniew Kmiec
*'''Email''': pwierzb@gumed.edu.pl
*'''Email''': pwierzb@gumed.edu.pl
*'''Institution''':Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. D?binki 1, PL 80-211 Gda��sk, Poland
*'''Institution''':Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. Dębinki 1, PL 80-211 Gdańsk, Poland e-mail: pwierzb@gumed.edu.pl
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=18217841682699620154&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
=='''Differentiating Human Embryonic Stem Cells''' ==
=='''''Differentiating Human Embryonic Stem Cells''''' ==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 366: Line 389:
|align="center"| B2M<ref name="ref7"/>
|align="center"| B2M<ref name="ref7"/>
|align="center"| beta-2-microglobulin
|align="center"| Beta-2-microglobulin
differentiating human embryonic stem cells
* During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 378: Line 401:
|align="center"| RPL13A<ref name="ref7"/>
|align="center"| RPL13A<ref name="ref7"/>
|align="center"|  ribosomal protein L13A
|align="center"|  Ribosomal protein L13A
differentiating human embryonic stem cells
* During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 389: Line 412:
|align="center"| SYBR
|align="center"| SYBR
|align="center"| AluSq <ref name="ref7"/>
|align="center"| AluSq<ref name="ref7"/>
|align="center"| Alu repeats, subfamily Sq
|align="center"| Alu repeats, subfamily Sq
differentiating human embryonic stem cells
* During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.
|align="center"| NA  
|align="center"| NA  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 402: Line 425:
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 411: Line 435:
*'''Institution''':Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium
*'''Institution''':Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=5445800682863294621&as_sdt=2005&sciodt=0,5&hl=en '''11'''](Based on Google Scholar [2017-09-01])
=='''Umbilical Vein Endothelial Cells'''==
=='''''Umbilical Vein Endothelial Cells'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 428: Line 454:
|align="center"| Beta-2-microglobulin  
|align="center"| Beta-2-microglobulin  
human umbilical vein endothelial cells on substrates with different stiffness
*Umbilical vein endothelial cells on substrates with different stiffness
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 440: Line 466:
|align="center"| Hypoxanthine phosphoribosyl-transferase 1
|align="center"| Hypoxanthine phosphoribosyl-transferase 1
human umbilical vein endothelial cells on substrates with different stiffness
*Umbilical vein endothelial cells on substrates with different stiffness
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000194 '''NM_000194''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000194 '''NM_000194''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 452: Line 478:
|align="center"| Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide
|align="center"| Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide
human umbilical vein endothelial cells on substrates with different stiffness
*Umbilical vein endothelial cells on substrates with different stiffness
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003406 '''NM_003406''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003406 '''NM_003406''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 461: Line 487:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 472: Line 500:
*'''Institution''':Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China
*'''Institution''':Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=1633611957861237654&as_sdt=2005&sciodt=0,5&hl=en '''13'''] (Based on Google Scholar [2017-09-01])
=='''During THP-1 Monocyte Differentiation Into Macrophages'''==
=='''''THP-1 Monocyte Differentiation Into Macrophages'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 487: Line 517:
|align="center"| ACTB<ref name="ref9"/>
|align="center"| ACTB<ref name="ref9"/>
|align="center"| b-actin
|align="center"| β-actin
PMA-induced THP-1 monocyte-to-macrophage differentiation
* PMA-induced THP-1 monocyte-to-macrophage differentiation
* THP-1 monocytes were obtained from ATCC (Manassas, Virginia, USA)
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 499: Line 530:
|align="center"| RPL37A<ref name="ref9"/>
|align="center"| RPL37A<ref name="ref9"/>
|align="center"| ribosomal protein L37a
|align="center"| Ribosomal protein L37a
PMA-induced THP-2 monocyte-to-macrophage differentiation
* PMA-induced THP-1 monocyte-to-macrophage differentiation
* THP-1 monocytes were obtained from ATCC (Manassas, Virginia, USA)
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000998.4 '''NM_000998.4''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000998.4 '''NM_000998.4''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 510: Line 542:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
===Evaluation Methods===  
===Evaluation Methods===  
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 521: Line 555:
*'''Institution''':Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany
*'''Institution''':Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=3186517875302726277&as_sdt=2005&sciodt=0,5&hl=en '''48'''](Based on Google Scholar [2017-09-01])
=='''Serous Ovarian Cancer'''==
=='''''Ovarian Cancer'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 538: Line 574:
|align="center"| Beta-glucuronidase  
|align="center"| Beta-glucuronidase  
serous ovarian cancer
* The human ovarian cancer cell line [https://www.atcc.org/en/Products/Cells_and_Microorganisms/By_Tissue/Ovary/CRL-3128.aspx '''''UACC-1598'''''] & [https://www.atcc.org/Products/All/HTB-77.aspx '''''SKOV3''''']
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000181 '''NM_000181''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000181 '''NM_000181''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 550: Line 586:
|align="center"| Peptidylprolyl isomerase A  
|align="center"| Peptidylprolyl isomerase A  
serous ovarian cancer
* The human ovarian cancer cell line [https://www.atcc.org/en/Products/Cells_and_Microorganisms/By_Tissue/Ovary/CRL-3128.aspx '''''UACC-1598'''''] & [https://www.atcc.org/Products/All/HTB-77.aspx '''''SKOV3''''']
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 562: Line 598:
|align="center"| TATA box binding protein  
|align="center"| TATA box binding protein  
serous ovarian cancer
* The human ovarian cancer cell line [https://www.atcc.org/en/Products/Cells_and_Microorganisms/By_Tissue/Ovary/CRL-3128.aspx '''''UACC-1598'''''] & [https://www.atcc.org/Products/All/HTB-77.aspx '''''SKOV3''''']
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194 '''NM_003194''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194 '''NM_003194''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 572: Line 608:
===Moleculer types===
===Molecular Types===
===Evaluation Methods===  
===Evaluation Methods===  
Line 580: Line 616:
*'''Name''':Xing Xie
*'''Name''':Xing Xie
*'''Institution''':Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2, *'''Institution''':Hangzhou 310006, China
*'''Institution''':Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2,Hangzhou 310006, China
=='''Normal Thyroid and Goiter Tissue'''==
===Citation Statistics===
===Reference Genes===
Cited by [https://scholar.google.com/scholar?cites=2097293336437431613&as_sdt=2005&sciodt=0,5&hl=en '''81'''] (Based on Google Scholar [2017-09-01])
=='''''Normal Thyroid & Goiter Tissue'''''==
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 596: Line 635:
|align="center"| ACTB<ref name="ref11"/>
|align="center"| ACTB<ref name="ref11"/>
|align="center"| Beta-actin
|align="center"| β-actin  
normal thyroid and goiter tissues
*Normal thyroid and goiter tissues
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 608: Line 647:
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 616: Line 655:
*'''Name''':Tania Weber Furlanetto  
*'''Name''':Tania Weber Furlanetto  
*'''Institute''':UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil
*'''Institution''':UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil
=='''Colonic and Vaginal Epithelial Cell Lines'''==
===Citation Statistics===
===Reference Genes===
Cited by [https://scholar.google.com/scholar?cites=14772624487340437287&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
=='''''Colonic and Vaginal Epithelial Cell Lines'''''==
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 632: Line 674:
|align="center"| PGK1<ref name="ref12"/>
|align="center"| PGK1<ref name="ref12"/>
|align="center"| phosphoglycerate kinase 1
|align="center"| Phosphoglycerate kinase 1
HT-29 cells
* HT-29 human colonic epithelial cells treated with probiotic and pathogenic bacteria.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000291 '''NM_000291''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000291 '''NM_000291''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 644: Line 687:
|align="center"|  RPLP0<ref name="ref12"/>
|align="center"|  RPLP0<ref name="ref12"/>
|align="center"| ribosomal protein large P0
|align="center"| Ribosomal protein large P0
VK2/E6E7 cells
* VK2/E6E7 human vaginal epithelial cells treated with probiotic and pathogenic bacteria.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001002 '''NM_001002''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001002 '''NM_001002''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 655: Line 698:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 666: Line 710:
*'''Institution''':School of Science and Technology, Sweden
*'''Institution''':School of Science and Technology, Sweden
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=17749917308073819947&as_sdt=2005&sciodt=0,5&hl=en '''4'''] (Based on Google Scholar [2017-09-01])
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 683: Line 729:
|align="center"| Signal recognition particle 14 kDa
|align="center"| Signal recognition particle 14 kDa
* Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
* Non-failed heart tissue
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/827342565 '''NM_003134''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/827342565 '''NM_003134''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 693: Line 740:
|align="center"| TPT1<ref name="ref13"/>
|align="center"| TPT1<ref name="ref13"/>
|align="center"| translationally-controlled 1
|align="center"| Translationally-controlled 1
* Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
* Non-failed heart tissue
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/555943846 '''NM_003295''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/555943846 '''NM_003295''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 705: Line 753:
|align="center"| EEF1A1<ref name="ref13"/>
|align="center"| EEF1A1<ref name="ref13"/>
|align="center"| eukaryotic elongation factor 1A1
|align="center"| Eukaryotic elongation factor 1A1
* Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
* Non-failed heart tissue
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/47419910 '''NM_015905  ''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/47419910 '''NM_015905  ''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 717: Line 766:
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 725: Line 774:
* '''Email''':vicky.cameron@otago.ac.nz
* '''Email''':vicky.cameron@otago.ac.nz
* '''Institution''': Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand
* '''Institution''': Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=15182072179042703374&as_sdt=2005&sciodt=0,5&hl=en '''40'''] (Based on Google Scholar [2017-09-01])
=='''Breast Cancer'''==
=='''''Breast Cancer'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 740: Line 791:
|align="center"|  ACTB<ref name="ref14"/>
|align="center"|  ACTB<ref name="ref14"/>
|align="center"| Beta actin
|align="center"| β-actin
breast cancer samples
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101.3 '''NM_001101''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 754: Line 805:
|align="center"| 40S ribosomal protein S23  
|align="center"| 40S ribosomal protein S23  
breast cancer samples
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001025.4 '''NM_001025''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001025.4 '''NM_001025''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 766: Line 817:
|align="center"| E3 ubiquitin-protein ligase HUWE1
|align="center"| E3 ubiquitin-protein ligase HUWE1
breast cancer samples
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_031407 '''NM_031407''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_031407 '''NM_031407''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 778: Line 829:
|align="center"| Elongation factor 1-alpha 1
|align="center"| Elongation factor 1-alpha 1
breast cancer samples
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001402.5 '''NM_001402''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001402.5 '''NM_001402''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 790: Line 841:
|align="center"| Splicing factor 3 subunit 1
|align="center"| Splicing factor 3 subunit 1
breast cancer samples
* Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_005877 '''NM_005877''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_005877 '''NM_005877''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 799: Line 850:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 809: Line 861:
*'''Institution''':SRC Bioclinicum, Moscow, Russia
*'''Institution''':SRC Bioclinicum, Moscow, Russia
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=12627318641896437747&as_sdt=2005&sciodt=0,5&hl=en '''42'''] (Based on Google Scholar [2017-09-01])
=='''Prostate Cancer Cells'''==
=='''''Prostate Cancer Cells'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 824: Line 878:
|align="center"| GAPDH<ref name="ref15"/>
|align="center"| GAPDH<ref name="ref15"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
prostate cancer cells
*Prostate cancer cells
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/576583510/ '''NM_002046''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/576583510/ '''NM_002046''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 836: Line 890:
|align="center"| SDHA<ref name="ref15"/>
|align="center"| SDHA<ref name="ref15"/>
|align="center"| succinate dehydrogenase complex, subunit A, flavoprotein(Fp)
|align="center"| Succinate dehydrogenase complex, subunit A, flavoprotein(Fp)
prostate cancer cells
*Prostate cancer cells
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168.2 '''NM_004168''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168.2 '''NM_004168''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 847: Line 901:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 856: Line 911:
*'''Institution''': Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil
*'''Institution''': Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=51592710566212111&as_sdt=2005&sciodt=0,5&hl=en '''17'''] (Based on Google Scholar [2017-09-01])
=='''Stomach Cancer'''==
=='''''Stomach Cancer'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 873: Line 930:
|align="center"| Beta-2-microglobulin
|align="center"| Beta-2-microglobulin
stomach cancer cell lines;all stomach tissues
* Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
* Five non-stomach cancer cell lines (JIMT1, SK-BR-3, SNU-C5, A549, and U87)
* two normal human cell lines(HDF, HMEC)
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 883: Line 942:
|align="center"| GAPDH<ref name="ref16"/>
|align="center"| GAPDH<ref name="ref16"/>
|align="center"| Ribosomal protein L29
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
stomach cancer cell lines
* Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 897: Line 956:
|align="center"| Ribosomal protein L29  
|align="center"| Ribosomal protein L29  
all stomach tissues
* Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000992 '''NM_000992''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000992 '''NM_000992''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 906: Line 965:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
===Evaluation Methods===  
===Evaluation Methods===  
Line 915: Line 975:
*'''Institution''':Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea
*'''Institution''':Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=17738168846180173643&as_sdt=2005&sciodt=0,5&hl=en '''56'''] (Based on Google Scholar [2017-09-01])
=='''Endometrioid Endometrial Carcinoma Tissues'''==
=='''''Endometrioid Endometrial Carcinoma Tissues'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 932: Line 994:
|align="center"| Peptidylprolyl isomerase A (Cyclophilin A)
|align="center"| Peptidylprolyl isomerase A (Cyclophilin A)
*endometrial tumor samples at different tumor degrees
*Endometrial tumor samples at different tumor degrees
* study groups regardless of sample type
*Study groups regardless of sample type
*endometrioid endometrial cancer samples
*Endometrioid endometrial cancer samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F: gaggaaaaccgtgtactattagc
* R:gggaccttgtctgcaaac
|align="center"| 113
|align="center"| 113
|align="center"| 60
|align="center"| 60
Line 946: Line 1,008:
|align="center"| Hypoxanthine phosphoribosyltransferase 1
|align="center"| Hypoxanthine phosphoribosyltransferase 1
* study groups regardless of sample type
*Study groups regardless of sample type
*endometrioid endometrial cancer samples
*Endometrioid endometrial cancer samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000194 '''NM_000194''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000194 '''NM_000194''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:ctggaaagaatgtcttgattgtg
* R: gaccttgaccatctttggatta
|align="center"| 104
|align="center"| 104
|align="center"| 60
|align="center"| 60
Line 959: Line 1,021:
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
* endometrioid endometrial cancer samples
*Endometrioid endometrial cancer samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:cccttcattgacctcaactacatg
* R: tgggatttccattgatgacaagc
|align="center"| 115
|align="center"| 115
|align="center"| 60
|align="center"| 60
Line 971: Line 1,033:
|align="center"| H3 histone, family 3A  
|align="center"| H3 histone, family 3A  
* endometrioid endometrial cancer samples
*Endometrioid endometrial cancer samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002107 '''NM_002107''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002107 '''NM_002107''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F: tgctcaggactttaaaacaga
* R: cacaggttggtgtcttcaa
|align="center"| 108
|align="center"| 108
|align="center"| 60
|align="center"| 60
Line 981: Line 1,043:
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===
===Evaluation Methods===
Line 991: Line 1,053:
*'''Institution''':''Angelo Nocivelli'' Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,
*'''Institution''':''Angelo Nocivelli'' Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=14772624487340437287&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
=='''Epicardial Adipose Tissue'''==
=='''''Epicardial Adipose Tissue'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 1,008: Line 1,072:
|align="center"| Peptidylprolyl isomerase A
|align="center"| Peptidylprolyl isomerase A
human epicardial adipose tissue
*Human epicardial adipose tissue
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 1,020: Line 1,084:
|align="center"| Glycerladehyde 3-phosphate dehydrogenase
|align="center"| Glycerladehyde 3-phosphate dehydrogenase
human epicardial adipose tissue
*Human epicardial adipose tissue
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 1,032: Line 1,096:
|align="center"| Ribosomal protein L27
|align="center"| Ribosomal protein L27
human epicardial adipose tissue
*Human epicardial adipose tissue
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000988 '''NM_000988''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000988 '''NM_000988''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 1,041: Line 1,105:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 1,052: Line 1,117:
*'''Institution''':Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada
*'''Institution''':Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=6845269495441518075&as_sdt=2005&sciodt=0,5&hl=en '''27'''] (Based on Google Scholar [2017-09-01])
=='''Umbilical Vein Endothelial Cells on Substrates with Different Stiffness'''==
=='''''Cartilage endplate of the lumbar spine'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 1,069: Line 1,136:
|align="center"| Succinate dehydrogenase complex, subunit A
|align="center"| Succinate dehydrogenase complex, subunit A
Cartilage Endplate of the Lumbar Spine
*Cartilage endplate of the lumbar Spine
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168 '''NM_004168''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168 '''NM_004168''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:agacctaaagcacctgaagacg
* R:atcaatccgcaccttgtagtct
|align="center"| 175
|align="center"| 175
|align="center"| 60
|align="center"| 60
Line 1,081: Line 1,148:
|align="center"| Beta-2-microglobulin  
|align="center"| Beta-2-microglobulin  
Cartilage Endplate of the Lumbar Spine
*Cartilage endplate of the lumbar Spine
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048.2 '''NM_004048''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048.2 '''NM_004048''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:atccatccgacattgaagttg
* R:ggcaggcatactcatctttttc
|align="center"| 150
|align="center"| 150
|align="center"| 60
|align="center"| 60
Line 1,093: Line 1,160:
|align="center"| Lactate dehydrogenase A  
|align="center"| Lactate dehydrogenase A  
Cartilage Endplate of the Lumbar Spine
*Cartilage endplate of the lumbar Spine
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_005566.3 '''NM_005566''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_005566.3 '''NM_005566''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:gcctgtatggagtggaatgaa
* R:ccaggatgtgtagcctttgag
|align="center"| 157
|align="center"| 157
|align="center"| 60
|align="center"| 60
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 1,113: Line 1,181:
*'''Institution''':Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China
*'''Institution''':Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=409926487862459985&as_sdt=2005&sciodt=0,5&hl=en '''13'''] (Based on Google Scholar [2017-09-01])
=='''Head and Neck Squamous Cell Carcinoma'''==
=='''''Head and Neck Squamous Cell Carcinoma'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 1,128: Line 1,198:
|align="center"| GAPDH<ref name="ref20"/>
|align="center"| GAPDH<ref name="ref20"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
* head and neck squamous cell carcinoma
* Head and neck squamous cell carcinoma
* All patients were Caucasian and heavy smokers and drinkers
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_002046 '''NM_002046''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:tgaacgggaagctcactgg
* R:tccaccaccctgttgctgta
|align="center"| 307
|align="center"| 307
|align="center"| 60
|align="center"| 60
Line 1,140: Line 1,211:
|align="center"| SDHA<ref name="ref20"/>
|align="center"| SDHA<ref name="ref20"/>
|align="center"| succinate dehydrogenase complex, subunit A, flavoprotein
|align="center"| Succinate dehydrogenase complex, subunit A, flavoprotein
* head and neck squamous cell carcinoma
* Head and neck squamous cell carcinoma
* All patients were Caucasian and heavy smokers and drinkers
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168 '''NM_004168''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168 '''NM_004168''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:agcaagctctatggagacct
* R:taatcgtactcatcaatccg
|align="center"| 200
|align="center"| 200
|align="center"| 60
|align="center"| 60
Line 1,152: Line 1,224:
===Moleculer types===
===Molecular Types===
===Evaluation Methods===  
===Evaluation Methods===  
Line 1,162: Line 1,234:
*'''Institution''':Centre National de la Recherche Scientifique, Montpellier F-34094, France
*'''Institution''':Centre National de la Recherche Scientifique, Montpellier F-34094, France
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=4966999011134229873&as_sdt=2005&sciodt=0,5&hl=en '''39'''] (Based on Google Scholar [2017-09-01])
=='''Cartilage Endplate of the Lumbar Spine'''==
=='''''Clear Cell Renal Cell Carcinoma'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 1,177: Line 1,251:
|align="center"|  PPIA<ref name="ref21"/>
|align="center"|  PPIA<ref name="ref21"/>
|align="center"| peptidylprolyl isomerase A (cyclophilin A)
|align="center"| Peptidylprolyl isomerase A (cyclophilin A)
ccRCC tissues
* Clear cell renal cell arcinoma samples & Healthy samples tissues
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021130 '''NM_021130''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 1,189: Line 1,263:
|align="center"|  RPS13<ref name="ref21"/>
|align="center"|  RPS13<ref name="ref21"/>
|align="center"| ribosomal protein S13
|align="center"| Ribosomal protein S13
ccRCC tissues
* Clear cell renal cell arcinoma samples & Healthy samples
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001017.2 '''NM_001017''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001017.2 '''NM_001017''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 1,200: Line 1,274:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 1,211: Line 1,286:
*'''Institution''':CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium
*'''Institution''':CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=2556083209952067092&as_sdt=2005&sciodt=0,5&hl=en '''23'''] (Based on Google Scholar [2017-09-01])
=='''Osteoarthritic Articular Cartilage'''==
=='''''Osteoarthritic Articular Cartilage'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
!  Gene symbol !!  Gene name !! Application Scope !!  Accession Number !! Primer !! PCR Size (bp) !! Tm !! Detection
!  Gene Symbol !!  Gene Name !! Application Scope !!  Accession Number !! Primers (5'-3')<br>[Forward/Reverse] !! PCR Size (bp) !! Tm !! Detection
| TBP<ref name="ref22"/>|| TATA-box binding protein ||
|align="center"| TBP<ref name="ref22"/>
* articular cartilage  
|align="center"|TATA-box binding protein ||
|| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194 '''NM_003194''']  
* Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_003194 '''NM_003194''']  
|nowrap style="font-size:9pt"|  
|nowrap style="font-size:9pt"|  
* F: 5-tgcacaggagccaagagtgaa-3
* R: 5-cacatcacagctccccacca-3
|| 132 || 56 ℃ ||SYBR
|align="center"| 132  
|align="center"| 56 ℃ 
|align="center"| SYBR
| RPL13A<ref name="ref22"/>|| polymerase II large subunit ||  
|align="center"| RPL13A<ref name="ref22"/>
* articular cartilage
|align="center"| Ribosomal protein S13 ||  
|| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']  
* Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F: 5-aaaaagcggatggtggttc-3
* R: 5-cttccggtagtggatcttgg-3
|| 168 || 56 ℃ ||SYBR
|align="center"| 168
|align="center"| 56 ℃ 
|align="center"| SYBR
| B2M<ref name="ref22"/>|| polymerase II large subunit ||  
|align="center"| B2M<ref name="ref22"/>|
* articular cartilage
|align="center"|Beta-2-microglobulin ||  
|| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
* Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004048 '''NM_004048''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F: 5-atgagtatgcctgccgtgtga-3
* R: 5-ggcatcttcaaacctccatg-3
|| 101 || 56 ℃ ||SYBR
|align="center"| 101
|align="center"| 56 ℃ 
|align="center"| SYBR
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
Line 1,253: Line 1,339:
*'''Email''': Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
*'''Email''': Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
*'''Institution''': Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain
*'''Institution''': Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=15105537215980678386&as_sdt=2005&sciodt=0,5&hl=en '''75'''] (Based on Google Scholar [2017-09-01])
=='''Hepatocellular Carcinoma'''==
=='''''Hepatocellular Carcinoma'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt"
{|class="wikitable sortable" style="font-size:10pt"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
!style="width=25% font-size:9pt "|  Application Scope  
!style="width=25% font-size:9pt "|  Application Scope  
! Accession Number  
! Accession Number  
! Primer
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp]  
! Size [bp]  
! Tm [℃]
! Tm [℃]
Line 1,268: Line 1,356:
|align="center"| HMBS<ref name="ref23"/>
|align="center"| HMBS<ref name="ref23"/>
|align="center"| hydroxymethylbilane synthase
|align="center"| Hydroxymethylbilane synthase
* Universial reference gene for gene expression studies in HCC  
* Universial reference gene for gene expression studies in HCC  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000190.3 '''NM_000190.3''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_000190.3 '''NM_000190.3''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
Line 1,282: Line 1,370:
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase  
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase  
* between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC  
* Tumoral and adjacent non-tumoral tissues derived from patients with HCC  
* among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182   
* Liver cancer cell lines: Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182   
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']     
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012423 '''NM_012423''']     
|nowrap style="font-size:9pt"|  
|nowrap style="font-size:9pt"|  
|align="center"| 87
|align="center"| 87
|align="center"| 56.4
|align="center"| 56.4
Line 1,293: Line 1,381:
|align="center"| UBC<ref name="ref23"/>
|align="center"| UBC<ref name="ref23"/>
|align="center"| ubiquitin C   
|align="center"| Ubiquitin C   
* for tumor tissues  
* Tumor tissues  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021009.3 '''NM_021009.3''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_021009.3 '''NM_021009.3''']  
|nowrap style="font-size:9pt"|  
|nowrap style="font-size:9pt"|  
Line 1,305: Line 1,393:
|align="center"|SDHA<ref name="ref23"/>
|align="center"|SDHA<ref name="ref23"/>
|align="center"| succinate dehydrogenase complex, subunit A   
|align="center"| Succinate dehydrogenase complex, subunit A   
* for five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
* Liver cancer cell lines: Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168.2 '''NM_004168.2''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_004168.2 '''NM_004168.2''']  
|nowrap style="font-size:9pt"|  
|nowrap style="font-size:9pt"|  
Line 1,317: Line 1,405:
===Moleculer types===
===Molecular Types===
* mRNA
* mRNA
Line 1,326: Line 1,414:
*'''Name''': Susanne Beckebaum
*'''Name''': Susanne Beckebaum
*'''Email''': Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
*'''Email''': susanne.beckebaum@uni-due.de
*'''Institution''': susanne.beckebaum@uni-due.de
*'''Institution''': Department of Gastroenterology and Hepatology, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=12922105542327270557&as_sdt=2005&sciodt=0,5&hl=en '''92'''] (Based on Google Scholar [2017-09-01])
<ref name="ref1">
<ref name="ref1">
Mehta R, Birerdinc A, Hossain N, et al. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples[J]. BMC Molecular Biology, 2010, 11(1): 39.
Vázquez-Blomquist D, Fernández J R, Miranda J, et al. Selection of reference genes for use in quantitative reverse transcription PCR assays when using interferons in U87MG[J]. Molecular biology reports, 2012, 39(12): 11167-11175.
<ref name="ref2">
<ref name="ref2">
Vázquez-Blomquist D, Fernández J R, Miranda J, et al. Selection of reference genes for use in quantitative reverse transcription PCR assays when using interferons in U87MG[J]. Molecular biology reports, 2012, 39(12): 11167-11175.
Mehta R, Birerdinc A, Hossain N, et al. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples[J]. BMC Molecular Biology, 2010, 11(1): 39.
<ref name="ref3">
<ref name="ref3">
Line 1,407: Line 1,498:
[[Category:Animals]][[Category:mRNA]][[Category:SYBR]][[Category:EvaGreen]][[Category:ACT]] [[Category:ACT]] [[Category:AluSq]] [[Category:B2M]][[Category:Cyclophilin]] [[Category:Cyclophilin]] [[Category:DDX5]] [[Category:EF1α]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]][[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GUSB]] [[Category:GUSB]] [[Category:Histone]] [[Category:HMBS]][[Category:HMBS]] [[Category:HPRT]] [[Category:HPRT]] [[Category:HUWE1]] [[Category:LDHA]] [[Category:PGK]] [[Category:PGK]] [[Category:polA]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:RPS]] [[Category:RPS]] [[Category:SDHA]] [[Category:SDHA]] [[Category:SDHA]] [[Category:SDHA]] [[Category:SF]] [[Category:SRP]] [[Category:TBP]] [[Category:TBP]] [[Category:TBP]] [[Category:TPT1]] [[Category:Ubiquitin]] [[Category:YWHAZ]] [[Category:YWHAZ]][[Category:Specific Tissue]]  [[Category:Different Developmental Stages]]  [[Category:Specific Cells]]  [[Category:Visceral Adipose Samples]]  [[Category:Tumor Related Studies]]  [[Category:Pathological conditions]]{{Template:BackToTop}}[[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]][[Category:Delta Ct]][[Category:RefFinder]]

Latest revision as of 13:47, 6 September 2017



Homo sapiens.png
  • Homo sapiens (Latin: "wise man") is the binomial nomenclature for the only extant human species. Homo is the human genus, which also includes Neanderthals and many other extinct species of hominin. H. sapiens is the only surviving species of the genus Homo. Modern humans are the subspecies Homo sapiens, which differentiates them from what has been argued to be their direct ancestor, Homo sapiens idaltu (Modified from Wikipedia).
  • Common Name: Human being, Wise man
  • NCBI Taxonomy

U87MG Cell Line

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
DDX5[1] RNA helicase
  • Using Interferons in U87MG Cell Line
125 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Using Interferons in U87MG Cell Line
138 60 SYBR
HMBS[1] Hydroxymethylbilane synthase
  • Using Interferons in U87MG Cell Line
150 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Iraldo Bello
  • Email:dania.vazquez@cigb.edu.cu
  • Institution:Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

Visceral Adipose Samples

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
ACTB[2] β-actin
  • Visceral adipose samples (were obtained from 10 patients diagnosed with morbid obesity)
  • One of the NAFLD spectrum diseases
  • Nine lean patientswith normal liver biopsies
NA 55 EvaGreen
RPII[2] RNA polymerase II
  • Visceral adipose samples (were obtained from 10 patients diagnosed with morbid obesity)
  • One of the NAFLD spectrum diseases
  • Nine lean patientswith normal liver biopsies
NA 60 EvaGreen

Molecular Types

  • mRNA

Evaluation Methods


  • Name: Ancha Baranova
  • Email: abaranov@gmu.edu
  • Institution:Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA

Citation Statistics

Cited by 72 (Based on Google Scholar [2017-09-01])

Lung Cancer

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
ACTB[3] β-actin NM_000937
111 58 SYBR
PPIA[3] Peptidylprolyl isomerase A, cydophilin A, romatase A NM_021130
179 58 SYBR
PGK1[3] Phosphoglycerate kinase-1 NM_000291
102 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Email:zhanguizhenjlu@163.com
  • Institution:Department of Central Laboratory, Second Hospital, Jilin University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

Mesenchymal Stromal Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
TBP[4] TATA-binding protein
  • Mesenchymal stromal cells from the bone marrow
  • Adipose-derived stromal cells
YWHAZ[4] Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Mesenchymal stromal cells from the bone marrow
  • Adipose-derived stromal cells

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Mandana Haack
  • Email:Mandana.Haack-Soerensen@regionh.dk
  • Institution:Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])


Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
GAPDH[5] Glyceraldehyde-3-phosphate dehydrogenase
  • Glioma of different grades (World Health Organization grades II-IV).
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
  • Tumor tissues and normal samples were from patients undergoing surgery.
222 55 SYBR
RPL13A[5] Ribosomal protein L13a
  • Glioma of different grades (World Health Organization grades II-IV).
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
  • Tumor tissues and normal samples were from patients undergoing surgery.
126 55 SYBR
CYC1[5] Cytochrome c-1
  • Glioma of different grades (World Health Organization grades II-IV).
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma.
  • Tumor tissues and normal samples were from patients undergoing surgery.
160 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Susanne Grube
  • Email:susanne.grube@med.uni-jena.de
  • Institution:Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

Metastatic Clear Cell Renal Cell Carcinoma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
RPL13[6] Ribosomal protein L13
  • 35 primary tumor nonmetastatic versus 35 mccRCC samples and matched metastasized T/C/M samples
164 59 SYBR
GUSB[6] Glucuronidase, beta
  • 152 samples and in paired Tand C(n=140) kidney samples
177 59 SYBR
RPLP0[6] Ribosomal protein, large, P0
  • Matchedtumor-control-metastasized ccRCC samples
307 58.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Zbigniew Kmiec
  • Email: pwierzb@gumed.edu.pl
  • Institution:Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. Dębinki 1, PL 80-211 Gdańsk, Poland e-mail: pwierzb@gumed.edu.pl

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Differentiating Human Embryonic Stem Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
B2M[7] Beta-2-microglobulin
  • During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.
86 60 SYBR
RPL13A[7] Ribosomal protein L13A
  • During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.
126 60 SYBR
AluSq[7] Alu repeats, subfamily Sq
  • During the differentiation of Human embryonic stem cells (UGENT 1 and UGENT2 cell line) which were induced for several days by addition of retinoic acid to the culture medium.

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Dieter Deforce
  • Email:Dieter.Deforce@UGent.be
  • Institution:Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium

Citation Statistics

Cited by 11(Based on Google Scholar [2017-09-01])

Umbilical Vein Endothelial Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
B2M[8] Beta-2-microglobulin
  • Umbilical vein endothelial cells on substrates with different stiffness
106 59 SYBR
HPRT-1[8] Hypoxanthine phosphoribosyl-transferase 1
  • Umbilical vein endothelial cells on substrates with different stiffness
195 59 SYBR
YWHAZ[8] Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide
  • Umbilical vein endothelial cells on substrates with different stiffness
94 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Hong Zhou
  • Email:zhouhtt1966@163.com
  • Institution:Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

THP-1 Monocyte Differentiation Into Macrophages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
ACTB[9] β-actin
  • PMA-induced THP-1 monocyte-to-macrophage differentiation
  • THP-1 monocytes were obtained from ATCC (Manassas, Virginia, USA)
150 60 SYBR
RPL37A[9] Ribosomal protein L37a
  • PMA-induced THP-1 monocyte-to-macrophage differentiation
  • THP-1 monocytes were obtained from ATCC (Manassas, Virginia, USA)
94 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Stefan Lorkowski
  • Email:stefan.lorkowski@uni-jena.de
  • Institution:Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany

Citation Statistics

Cited by 48(Based on Google Scholar [2017-09-01])

Ovarian Cancer

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
GUSB[10] Beta-glucuronidase NM_000181
160 60 or 63 SYBR
PPIA[10] Peptidylprolyl isomerase A NM_021130
118 61 or 63 SYBR
TBP[10] TATA box binding protein NM_003194
132 62 or 63 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Xing Xie
  • Email:xiex@mail.hz.zj.cn
  • Institution:Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2,Hangzhou 310006, China

Citation Statistics

Cited by 81 (Based on Google Scholar [2017-09-01])

Normal Thyroid & Goiter Tissue

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
ACTB[11] β-actin
  • Normal thyroid and goiter tissues
140 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Tania Weber Furlanetto
  • Email:taniafurlanetto@gmail.com
  • Institution:UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

Colonic and Vaginal Epithelial Cell Lines

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
PGK1[12] Phosphoglycerate kinase 1
  • HT-29 human colonic epithelial cells treated with probiotic and pathogenic bacteria.
RPLP0[12] Ribosomal protein large P0
  • VK2/E6E7 human vaginal epithelial cells treated with probiotic and pathogenic bacteria.

Molecular Types

  • mRNA

Evaluation Methods


  • Name: Nikolai Scherbak
  • Email:nikolai.scherbak@oru.se
  • Institution:School of Science and Technology, Sweden

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])


Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
SRP14[13] Signal recognition particle 14 kDa
  • Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
  • Non-failed heart tissue
181 60~61 SYBR
TPT1[13] Translationally-controlled 1
  • Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
  • Non-failed heart tissue
164 58~61 SYBR
EEF1A1[13] Eukaryotic elongation factor 1A1
  • Tissue from the left ventricular free wall of the myocardium (from explanted failed hearts)
  • Non-failed heart tissue
183 60~63 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Vicky A Cameron
  • Email:vicky.cameron@otago.ac.nz
  • Institution: Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand

Citation Statistics

Cited by 40 (Based on Google Scholar [2017-09-01])

Breast Cancer

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
ACTB[14] β-actin
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
140 64 SYBR
RPS23[14] 40S ribosomal protein S23
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
110 64 SYBR
HUWE1[14] E3 ubiquitin-protein ligase HUWE1
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
137 64 SYBR
EEF1A1[14] Elongation factor 1-alpha 1
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
208 64 SYBR
SF3A1[14] Splicing factor 3 subunit 1
  • Different breast cancers and normal breast epithelium from breast cancer patients and epithelium from cancer-free patients.
224 64 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Alexander G Tonevitsky
  • Email:d.maltseva@bioclinicum.com
  • Institution:SRC Bioclinicum, Moscow, Russia

Citation Statistics

Cited by 42 (Based on Google Scholar [2017-09-01])

Prostate Cancer Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
GAPDH[15] Glyceraldehyde-3-phosphate dehydrogenase
  • Prostate cancer cells
SDHA[15] Succinate dehydrogenase complex, subunit A, flavoprotein(Fp)
  • Prostate cancer cells

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Gisele Branchini
  • Email:giseleb@ufcspa.edu.br
  • Institution: Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

Stomach Cancer

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
B2M[16] Beta-2-microglobulin
  • Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
  • Five non-stomach cancer cell lines (JIMT1, SK-BR-3, SNU-C5, A549, and U87)
  • two normal human cell lines(HDF, HMEC)
114 58 SYBR
GAPDH[16] Glyceraldehyde-3-phosphate dehydrogenase
  • Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
177 58 SYBR
RPL29[16] Ribosomal protein L29
  • Six stomach tumor cell lines (SNU-216, SNU-638, SNU-719, AGS, MKN-28 and KATOIII)
120 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Sung-Ho Goh
  • Email:andrea@ncc.re.kr
  • Institution:Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea

Citation Statistics

Cited by 56 (Based on Google Scholar [2017-09-01])

Endometrioid Endometrial Carcinoma Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
PPIA[17] Peptidylprolyl isomerase A (Cyclophilin A)
  • Endometrial tumor samples at different tumor degrees
  • Study groups regardless of sample type
  • Endometrioid endometrial cancer samples
113 60 SYBR
HPRT1[17] Hypoxanthine phosphoribosyltransferase 1
  • Study groups regardless of sample type
  • Endometrioid endometrial cancer samples
104 60 SYBR
GAPDH[17] Glyceraldehyde-3-phosphate dehydrogenase
  • Endometrioid endometrial cancer samples
115 60 SYBR
H3F3A[17] H3 histone, family 3A
  • Endometrioid endometrial cancer samples
108 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Eliana Bignotti
  • Email:cromani76@gmail.com
  • Institution:Angelo Nocivelli Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

Epicardial Adipose Tissue

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
CYCA[18] Peptidylprolyl isomerase A
  • Human epicardial adipose tissue
GAPDH[18] Glycerladehyde 3-phosphate dehydrogenase
  • Human epicardial adipose tissue
RPL27[18] Ribosomal protein L27
  • Human epicardial adipose tissue

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Denis Richard
  • Email:Denis.Richard@criucpq.ulaval.ca
  • Institution:Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada

Citation Statistics

Cited by 27 (Based on Google Scholar [2017-09-01])

Cartilage endplate of the lumbar spine

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
SDHA[19] Succinate dehydrogenase complex, subunit A
  • Cartilage endplate of the lumbar Spine
175 60 SYBR
B2M[19] Beta-2-microglobulin
  • Cartilage endplate of the lumbar Spine
150 60 SYBR
LDHA[19] Lactate dehydrogenase A
  • Cartilage endplate of the lumbar Spine
157 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Shun-Wu Fan
  • Email:zzj-0708@163.com
  • Institution:Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

Head and Neck Squamous Cell Carcinoma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
GAPDH[20] Glyceraldehyde-3-phosphate dehydrogenase
  • Head and neck squamous cell carcinoma
  • All patients were Caucasian and heavy smokers and drinkers
307 60 SYBR
SDHA[20] Succinate dehydrogenase complex, subunit A, flavoprotein
  • Head and neck squamous cell carcinoma
  • All patients were Caucasian and heavy smokers and drinkers
200 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Jean-Paul Brouillet
  • Email:jpbrouillet@gmail.com
  • Institution:Centre National de la Recherche Scientifique, Montpellier F-34094, France

Citation Statistics

Cited by 39 (Based on Google Scholar [2017-09-01])

Clear Cell Renal Cell Carcinoma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
PPIA[21] Peptidylprolyl isomerase A (cyclophilin A)
  • Clear cell renal cell arcinoma samples & Healthy samples tissues
129 60 SYBR
RPS13[21] Ribosomal protein S13
  • Clear cell renal cell arcinoma samples & Healthy samples
153 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name:Christophe E Pierreux
  • Email:christophe.pierreux@uclouvain.be
  • Institution:CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

Osteoarthritic Articular Cartilage

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
PCR Size (bp) Tm Detection
TBP[22] TATA-box binding protein
  • Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
132 56 ℃  SYBR
RPL13A[22] Ribosomal protein S13
  • Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
168 56 ℃  SYBR
B2M[22]| Beta-2-microglobulin
  • Human articular cartilage (from femoral heads & the femoral condyles & tibial plateaux)
101 56 ℃  SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name: Antonio Gonzalez
  • Email: Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
  • Institution: Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain

Citation Statistics

Cited by 75 (Based on Google Scholar [2017-09-01])

Hepatocellular Carcinoma

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
HMBS[23] Hydroxymethylbilane synthase
  • Universial reference gene for gene expression studies in HCC
113 56.4 SYBR
GAPDH[23] Glyceraldehyde-3-phosphate dehydrogenase
  • Tumoral and adjacent non-tumoral tissues derived from patients with HCC
  • Liver cancer cell lines: Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
87 56.4 SYBR
UBC[23] Ubiquitin C
  • Tumor tissues
124 56.4 SYBR
SDHA[23] Succinate dehydrogenase complex, subunit A
  • Liver cancer cell lines: Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
86 56.4 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name: Susanne Beckebaum
  • Email: susanne.beckebaum@uni-due.de
  • Institution: Department of Gastroenterology and Hepatology, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.

Citation Statistics

Cited by 92 (Based on Google Scholar [2017-09-01])


  1. 1.0 1.1 1.2 Vázquez-Blomquist D, Fernández J R, Miranda J, et al. Selection of reference genes for use in quantitative reverse transcription PCR assays when using interferons in U87MG[J]. Molecular biology reports, 2012, 39(12): 11167-11175.
  2. 2.0 2.1 Mehta R, Birerdinc A, Hossain N, et al. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples[J]. BMC Molecular Biology, 2010, 11(1): 39.
  3. 3.0 3.1 3.2 Ali H, Du Z, Li X, et al. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro[J]. Molecular medicine reports, 2015, 11(5): 3767-3773.
  4. 4.0 4.1 Tratwal J, Follin B, Ekblond A, Kastrup J, Haack-Sørensen M. Identification of a common reference gene pair for qPCR in human mesenchymal stromal cells from different tissue sources treated with VEGF. BMC Mol Biol. 2014 May 28;15:11. doi: 10.1186/1471-2199-15-11. PubMed PMID: 24885696; PubMed Central PMCID: PMC4045907.
  5. 5.0 5.1 5.2 Grube S, Göttig T, Freitag D, Ewald C, Kalff R, Walter J. Selection of suitable reference genes for expression analysis in human glioma using RT-qPCR. J Neurooncol. 2015 May;123(1):35-42. doi: 10.1007/s11060-015-1772-7. Epub 2015 Apr 11. PubMed PMID: 25862007.
  6. 6.0 6.1 6.2 Wierzbicki P M, Klacz J, Rybarczyk A, et al. Identification of a suitable qPCR reference gene in metastatic clear cell renal cell carcinoma[J]. Tumor Biology, 2014, 35(12): 12473-12487.
  7. 7.0 7.1 7.2 Vossaert L, O’Leary T, Van Neste C, et al. Reference loci for RT-qPCR analysis of differentiating human embryonic stem cells[J]. BMC molecular biology, 2013, 14(1): 21.
  8. 8.0 8.1 8.2 Chen G, Zhao L, Feng J, et al. Validation of reliable reference genes for real-time PCR in human umbilical vein endothelial cells on substrates with different stiffness[J]. PLoS One, 2013, 8(6): e67360.
  9. 9.0 9.1 Maeß M B, Sendelbach S, Lorkowski S. Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages[J]. BMC molecular biology, 2010, 11(1): 90.
  10. 10.0 10.1 10.2 Li Y L, Ye F, Hu Y, et al. Identification of suitable reference genes for gene expression studies of human serous ovarian cancer by real-time polymerase chain reaction[J]. Analytical biochemistry, 2009, 394(1): 110-116.
  11. Weber R, Bertoni A P S, Bessestil L W, et al. Validation of reference genes for normalization gene expression in reverse transcription quantitative PCR in human normal thyroid and goiter tissue[J]. BioMed research international, 2014, 2014.
  12. 12.0 12.1 Jacobsen A V, Yemaneab B T, Jass J, et al. Reference gene selection for qPCR Is dependent on cell type rather than treatment in colonic and vaginal human epithelial cell lines[J]. PloS one, 2014, 9(12): e115592.
  13. 13.0 13.1 13.2 Pilbrow A P, Ellmers L J, Black M A, et al. Genomic selection of reference genes for real-time PCR in human myocardium[J]. BMC medical genomics, 2008, 1(1): 64.
  14. 14.0 14.1 14.2 14.3 14.4 Maltseva D V, Khaustova N A, Fedotov N N, et al. High-throughput identification of reference genes for research and clinical RT-qPCR analysis of breast cancer samples[J]. Journal of clinical bioinformatics, 2013, 3(1): 13.
  15. 15.0 15.1 Souza A F D, Brum I S, Neto B S, et al. Reference gene for primary culture of prostate cancer cells[J]. Molecular biology reports, 2013, 40(4): 2955-2962.
  16. 16.0 16.1 16.2 Rho H W, Lee B C, Choi E S, et al. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR[J]. BMC cancer, 2010, 10(1): 240.
  17. 17.0 17.1 17.2 17.3 Romani C, Calza S, Todeschini P, et al. Identification of optimal reference genes for gene expression normalization in a wide cohort of endometrioid endometrial carcinoma tissues[J]. PloS one, 2014, 9(12): e113781.
  18. 18.0 18.1 18.2 Chechi K, Gelinas Y, Mathieu P, et al. Validation of reference genes for the relative quantification of gene expression in human epicardial adipose tissue[J]. PloS one, 2012, 7(4): e32265.
  19. 19.0 19.1 19.2 Zhou Z J, Zhang J F, Xia P, et al. Selection of suitable reference genes for normalization of quantitative real-time polymerase chain reaction in human cartilage endplate of the lumbar spine[J]. PLoS One, 2014, 9(2): e88892.
  20. 20.0 20.1 Lallemant B, Evrard A, Combescure C, et al. Reference gene selection for head and neck squamous cell carcinoma gene expression studies[J]. BMC Molecular Biology, 2009, 10(1): 78.
  21. 21.0 21.1 Dupasquier S, Delmarcelle A S, Marbaix E, et al. Validation of housekeeping gene and impact on normalized gene expression in clear cell renal cell carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression[J]. BMC molecular biology, 2014, 15(1): 9.
  22. 22.0 22.1 22.2 Pombo-Suarez M, Calaza M, Gomez-Reino J J, et al. Reference genes for normalization of gene expression studies in human osteoarthritic articular cartilage[J]. BMC molecular biology, 2008, 9(1): 17.
  23. 23.0 23.1 23.2 23.3 Cicinnati V R, Shen Q, Sotiropoulos G C, et al. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR[J]. BMC cancer, 2008, 8(1): 350.
