Difference between revisions of "Homo sapiens"

From ICG
Jump to navigation Jump to search
Line 1,305: Line 1,305:
 
*'''Institution''': Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain
 
*'''Institution''': Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''74''' (Based on Google Scholar [2017-06-16])
+
Cited by '''75''' (Based on Google Scholar [2017-06-23])
  
 
=='''Hepatocellular Carcinoma'''==
 
=='''Hepatocellular Carcinoma'''==

Revision as of 14:24, 23 June 2017

Contents

Visceral Adipose Samples

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[1] β-actin
  • Visceral adipose samples
NM_000937
  • F:CTCTTCCAGCCTTCCTTCCT
  • R:AGCACTGTGTTGGCGTACAG
NA 55 EvaGreen
RPII [1] RNA polymerase II
  • Visceral adipose samples
NM_001102
  • F:CTTCACGGTGCTGGGCATT
  • R:GTGCGGCTGCTTCCATAA
NA 60 EvaGreen

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ancha Baranova
  • Email: abaranov@gmu.edu
  • Institution:Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA

Citation Statistics

Cited by 73 (Based on Google Scholar [2017-06-01])

U87MG Cell Line

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
DDX5[2] RNA helicase
  • Using Interferons in U87MG Cell Line
NM_004396
  • F:TAGAGGTCACAACTGCCCGAAG
  • R:GGCCATCCCTGAGCTTGAATAG
125 60 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • Using Interferons in U87MG Cell Line
NM_002046
  • F:CCATGGGTGGAATCATATTGGA
  • R:TCAACGGATTTGGTCGTATTGG
138 60 SYBR
HMBS[2] Hydroxymethylbilane synthase
  • Using Interferons in U87MG Cell Line
NM_000190
  • F:GGAATGTTACGAGCAGTGATGC
  • R:CCTGACTGGAGGAGTCTGGAGT
150 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Iraldo Bello
  • Email:dania.vazquez@cigb.edu.cu
  • Institution:Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Lung Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[3] β-actin
  • Lung cancer cell lines
NM_000937
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TACTCCTGCTTGCTGATCCA
111 58 SYBR
PPIA[3] Peptidylprolyl isomerase A, cydophilin A, romatase A
  • Lung cancer cell lines
NM_021130
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TGCTGGTCTTGCCATTCCT
179 58 SYBR
PGK1[3] Phosphoglycerate kinase-1
  • Lung cancer cell lines
NM_000291
  • F:GCCACTTGCTGTGCCAAATG
  • R:CCCAGGAAGGACTTTACCTT
102 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:GUIZHEN ZHANG
  • Email:zhanguizhenjlu@163.com
  • Institution:Department of Central Laboratory, Second Hospital, Jilin University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Mesenchymal Stromal Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TBP[4] TATA-binding protein
  • Mesenchymal stromal cells from the bone marrow
  • Adipose-derived stromal cells
NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
NA 60 SYBR
YWHAZ[4] Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Mesenchymal stromal cells from the bone marrow
  • Adipose-derived stromal cells
NM_001135702
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Mandana Haack
  • Email:Mandana.Haack-Soerensen@regionh.dk
  • Institution:Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])

Glioma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[5] Glyceraldehyde-3-phosphate dehydrogenase
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_002046
  • F:TCGCCAGCCGAGCCACATC
  • R:CGTTCTCAGCCTTGACGGTGC
222 55 SYBR
RPL13A[5] Ribosomal protein L13a
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R: TTGAGGACCTCTGTGTATTTGTCAA
126 55 SYBR
CYC1[5] Cytochrome c-1
  • Glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_001916
  • F:GAGGTGGAGGTTCAAGACGG
  • R:TAGCTCGCACGATGTAGCTG
160 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Susanne Grube
  • Email:susanne.grube@med.uni-jena.de
  • Institution:Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-01])

Metastatic Clear Cell Renal Cell Carcinoma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL13[6] Ribosomal protein L13
  • 35 primary tumor nonmetastatic versus 35 mccRCC samples and matched metastasized T/C/M samples
NM_000977
  • F:TTCCGCTCGGCTGTTTTCCTG
  • R:GGGCCTTACGTCTGCGGATCTTA
164 59 SYBR
GUSB[6] Glucuronidase, beta
  • 152 samples and in paired Tand C(n=140) kidney samples
NM_000181
  • F:ATGCAGGTGATGGAAGAAGTGGTG
  • R:AGAGTTGCTCACAAAGGTCACAGG
177 59 SYBR
RPLP0[6] Ribosomal protein, large, P0
  • Matchedtumor-control-metastasized ccRCC samples
NM_001002
  • F:TAAACCCTGCGTGGCAATCCCTG
  • R:TGAACACAAAGCCCACATTCCCC
307 58.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Zbigniew Kmiec
  • Email: pwierzb@gumed.edu.pl
  • Institution:Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. Dębinki 1, PL 80-211 Gdańsk, Poland e-mail: pwierzb@gumed.edu.pl

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-06-01])

Differentiating Human Embryonic Stem Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
B2M[7] Beta-2-microglobulin
  • Differentiating human embryonic stem cells
NM_004048
  • F:TGCTGTCTCCATGTTTGATGTATCT
  • R:TCTCTGCTCCCCACCTCTAAGT
86 60 SYBR
RPL13A[7] Ribosomal protein L13A
  • Differentiating human embryonic stem cells
NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R:TTGAGGACCTCTGTGTATTTGTCAA
126 60 SYBR
AluSq [7] Alu repeats, subfamily Sq
  • Differentiating human embryonic stem cells
NA
  • F:CATGGTGAAACCCCGTCTCTA
  • R:GCCTCAGCCTCCCGAGTAG
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Dieter Deforce
  • Email:Dieter.Deforce@UGent.be
  • Institution:Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])

Umbilical Vein Endothelial Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
B2M[8] Beta-2-microglobulin
  • Umbilical vein endothelial cells on substrates with different stiffness
NM_004048
  • F:CACCCCCACTGAAAAAGATGAG
  • R:CCTCCATGATGCTGCTTACATG
106 59 SYBR
HPRT-1[8] Hypoxanthine phosphoribosyl-transferase 1
  • Umbilical vein endothelial cells on substrates with different stiffness
NM_000194
  • F:GACCAGTCAACAGGGGACAT
  • R:AACACTTCGTGGGGTCCTTTTC
195 59 SYBR
YWHAZ[8] Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide
  • Umbilical vein endothelial cells on substrates with different stiffness
NM_003406
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
94 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Hong Zhou
  • Email:zhouhtt1966@163.com
  • Institution:Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-16])

THP-1 Monocyte Differentiation Into Macrophages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[9] β-actin
  • PMA-induced THP-1 monocyte-to-macrophage differentiation
NM_001101
  • F:ATTGCCGACAGGATGCAGAA
  • R:GCTGATCCACATCTGCTGGAA
150 60 SYBR
RPL37A[9] Ribosomal protein L37a
  • PMA-induced THP-2 monocyte-to-macrophage differentiation
NM_000998.4
  • F:ATTGAAATCAGCCAGCACGC
  • R:AGGAACCACAGTGCCAGATCC
94 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Stefan Lorkowski
  • Email:stefan.lorkowski@uni-jena.de
  • Institution:Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany

Citation Statistics

Cited by 46 (Based on Google Scholar [2017-06-16])

Ovarian Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GUSB[10] Beta-glucuronidase
  • Serous ovarian cancer
NM_000181
  • F:AGCCAGTTCCTCATCAATGG
  • R:GGTAGTGGCTGGTACGGAAA
160 60 or 63 SYBR
PPIA[10] Peptidylprolyl isomerase A
  • Serous ovarian cancer
NM_021130
  • F:AGACAAGGTCCCAAAGAC
  • R:ACCACCCTGACACATAAA
118 61 or 63 SYBR
TBP[10] TATA box binding protein
  • Serous ovarian cancer
NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
132 62 or 63 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Xing Xie
  • Email:xiex@mail.hz.zj.cn
  • Institution:Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2,Hangzhou 310006, China

Citation Statistics

Cited by 80 (Based on Google Scholar [2017-06-23])

Normal Thyroid & Goiter Tissue

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[11] β-actin
  • Normal thyroid and goiter tissues
NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAATGCA
140 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Tania Weber Furlanetto
  • Email:taniafurlanetto@gmail.com
  • Institution:UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-16])

Colonic and Vaginal Epithelial Cell Lines

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PGK1[12] Phosphoglycerate kinase 1
  • Ht-29 cells
NM_000291
  • F:GAGATGATTATTGGTGGTGGAA
  • R:AGTCAACAGGCAAGGTAATC
NA 60 SYBR
RPLP0[12] Ribosomal protein large P0
  • Vk2/E6e7 cells
NM_001002
  • F:ACAATGGCAGCATCTACA
  • R:GTAATCCGTCTCCACAGA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Nikolai Scherbak
  • Email:nikolai.scherbak@oru.se
  • Institution:School of Science and Technology, Sweden

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-16])

Myocardium

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SRP14[13] Signal recognition particle 14 kDa
  • Myocardium
NM_003134
  • F:CAGATGGCTTATTCAAACCTCCT
  • R:ATGCCCTTTACTGTGCTGCT
181 60~61 SYBR
TPT1[13] Translationally-controlled 1
  • Myocardium
NM_003295
  • F:AAATGTTAACAAATGTGGCAATTAT
  • R:AACAATGCCTCCACTCCAAA
164 58~61 SYBR
EEF1A1[13] Eukaryotic elongation factor 1A1
  • Myocardium
NM_015905
  • F:CTTTGGGTCGCTTTGCTGTT
  • R:CCGTTCTTCCACCACTGATT
183 60~63 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Vicky A Cameron
  • Email:vicky.cameron@otago.ac.nz
  • Institution: Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-06-16])

Breast Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[14] β-actin
  • Breast cancer samples
NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAACGCA
140 64 SYBR
RPS23[14] 40S ribosomal protein S23
  • Breast cancer samples
NM_001025
  • F:CGGTGCTTCTCTCTTTCGCT
  • R:ATGCCACTTCTGGTCTCGT
110 64 SYBR
HUWE1[14] E3 ubiquitin-protein ligase HUWE1
  • Breast cancer samples
NM_031407
  • F:CAGAGTTGGACAGAGTGAAA
  • R:TACACAGAGAGAGGAGGACA
137 64 SYBR
EEF1A1[14] Elongation factor 1-alpha 1
  • Breast cancer samples
NM_001402
  • F:TGAAAACTACCCCTAAAAGCCA
  • R: TATCCAAGACCCAGGCATACT
208 64 SYBR
SF3A1[14] Splicing factor 3 subunit 1
  • Breast cancer samples
NM_005877
  • F:AAGGGTCCAGTGTCCATCAAAGT
  • R:GCCATGTTGTAGTAAGCCAGTGAG
224 64 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name:Alexander G Tonevitsky
  • Email:d.maltseva@bioclinicum.com
  • Institution:SRC Bioclinicum, Moscow, Russia

Citation Statistics

Cited by 36 (Based on Google Scholar [2017-06-16])

Prostate Cancer Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[15] Glyceraldehyde-3-phosphate dehydrogenase
  • Prostate cancer cells
NM_002046
  • F:CTTTGTCAAGCTCATTTCCTGG
  • R:TCTTCCTCTTGTGCTCTTGC
133 NA SYBR
SDHA[15] Succinate dehydrogenase complex, subunit A, flavoprotein(Fp)
  • Prostate cancer cells
NM_004168
  • F:TGGTTGTCTTTGGTCGGG
  • R:GCGTTTGGTTTAATTGGAGGG
85 NA SYBR

Molecular Types

  • mRNA

Evaluation Methods