Difference between revisions of "Homo sapiens"

From ICG
Jump to navigation Jump to search
Line 643: Line 643:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 676: Line 676:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 687: Line 687:
 
*'''Email''':nikolai.scherbak@oru.se
 
*'''Email''':nikolai.scherbak@oru.se
 
*'''Institution''':School of Science and Technology, Sweden
 
*'''Institution''':School of Science and Technology, Sweden
 +
===Citation Statistics===
 +
Cited by '''4''' (Based on Google Scholar [2017-06-16])
  
 
=='''Myocardium'''==
 
=='''Myocardium'''==

Revision as of 09:35, 16 June 2017

Contents

Bisceral Adipose Samples

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[1] β-Actin

visceral adipose samples

NM_000937
  • F:CTCTTCCAGCCTTCCTTCCT
  • R:AGCACTGTGTTGGCGTACAG
NA 55 EvaGreen
RPII [1] RNA polymerase II

visceral adipose samples

NM_001102
  • F:CTTCACGGTGCTGGGCATT
  • R:GTGCGGCTGCTTCCATAA
NA 60 EvaGreen

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ancha Baranova
  • Email: abaranov@gmu.edu
  • Institution:Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA

Citation Statistics

Cited by 73 (Based on Google Scholar [2017-06-01])

Using Interferons in U87MG

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
DDX5[2] RNA helicase

U87MG

NM_004396
  • F:TAGAGGTCACAACTGCCCGAAG
  • R:GGCCATCCCTGAGCTTGAATAG
125 60 SYBR
GAPDH[2] glyceraldehyde-3-phosphate dehydrogenase

U87MG

NM_002046
  • F:CCATGGGTGGAATCATATTGGA
  • R:TCAACGGATTTGGTCGTATTGG
138 60 SYBR
HMBS[2] hydroxymethylbilane synthase

U87MG

NM_000190
  • F:GGAATGTTACGAGCAGTGATGC
  • R:CCTGACTGGAGGAGTCTGGAGT
150 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Iraldo Bello
  • Email:dania.vazquez@cigb.edu.cu
  • Institution:Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Lung Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[3] β -actin

lung cancer cell lines

NM_000937
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TACTCCTGCTTGCTGATCCA
111 58 SYBR
PPIA[3] Peptidylprolyl isomerase A, cydophilin A, romatase A

lung cancer cell lines

NM_021130
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TGCTGGTCTTGCCATTCCT
179 58 SYBR
PGK1[3] Phosphoglycerate kinase-1

lung cancer cell lines

NM_000291
  • F:GCCACTTGCTGTGCCAAATG
  • R:CCCAGGAAGGACTTTACCTT
102 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:GUIZHEN ZHANG
  • Email:zhanguizhenjlu@163.com
  • Institution:Department of Central Laboratory, Second Hospital, Jilin University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Mesenchymal Stromal Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TBP[4] TATA-binding protein
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells
NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
NA 60 SYBR
YWHAZ[4] tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells
NM_001135702
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Mandana Haack
  • Email:Mandana.Haack-Soerensen@regionh.dk
  • Institution:Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])

Glioma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[5] Glyceraldehyde-3-phosphate dehydrogenase
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_002046
  • F:TCGCCAGCCGAGCCACATC
  • R:CGTTCTCAGCCTTGACGGTGC
222 55 SYBR
RPL13A[5] Ribosomal protein L13a
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R: TTGAGGACCTCTGTGTATTTGTCAA
126 55 SYBR
CYC1[5] Cytochrome c-1
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_001916
  • F:GAGGTGGAGGTTCAAGACGG
  • R:TAGCTCGCACGATGTAGCTG
160 55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Susanne Grube
  • Email:susanne.grube@med.uni-jena.de
  • Institution:Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-01])

Metastatic Clear Cell Renal Cell Carcinoma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL13[6] Ribosomal protein L13
  • 35 primary tumor nonmetastatic versus 35 mccRCC samples and matched metastasized T/C/M samples
NM_000977
  • F:TTCCGCTCGGCTGTTTTCCTG
  • R:GGGCCTTACGTCTGCGGATCTTA
164 59 Sybr
GUSB[6] Glucuronidase, beta
  • total 152 samples and in paired Tand C(n=140) kidney samples
NM_000181
  • F:ATGCAGGTGATGGAAGAAGTGGTG
  • R:AGAGTTGCTCACAAAGGTCACAGG
177 59 Sybr
RPLP0[6] Ribosomal protein, large, P0
  • matchedtumor-control-metastasized ccRCC samples
NM_001002
  • F:TAAACCCTGCGTGGCAATCCCTG
  • R:TGAACACAAAGCCCACATTCCCC
307 58.5 Sybr

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Zbigniew Kmiec
  • Email: pwierzb@gumed.edu.pl
  • Institution:Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. D?binki 1, PL 80-211 Gda��sk, Poland

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-06-01])

Differentiating Human Embryonic Stem Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[7] beta-2-microglobulin

differentiating human embryonic stem cells

NM_004048
  • F:TGCTGTCTCCATGTTTGATGTATCT
  • R:TCTCTGCTCCCCACCTCTAAGT
86 60 SYBR
RPL13A[7] ribosomal protein L13A

differentiating human embryonic stem cells

NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R:TTGAGGACCTCTGTGTATTTGTCAA
126 60 SYBR
AluSq [7] Alu repeats, subfamily Sq

differentiating human embryonic stem cells

NA
  • F:CATGGTGAAACCCCGTCTCTA
  • R:GCCTCAGCCTCCCGAGTAG
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Dieter Deforce
  • Email:Dieter.Deforce@UGent.be
  • Institution:Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])

Umbilical Vein Endothelial Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[8] Beta-2-microglobulin

human umbilical vein endothelial cells on substrates with different stiffness

NM_004048
  • F:CACCCCCACTGAAAAAGATGAG
  • R:CCTCCATGATGCTGCTTACATG
106 59 SYBR
HPRT-1[8] Hypoxanthine phosphoribosyl-transferase 1

human umbilical vein endothelial cells on substrates with different stiffness

NM_000194
  • F:GACCAGTCAACAGGGGACAT
  • R:AACACTTCGTGGGGTCCTTTTC
195 59 SYBR
YWHAZ[8] Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide

human umbilical vein endothelial cells on substrates with different stiffness

NM_003406
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
94 59 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Hong Zhou
  • Email:zhouhtt1966@163.com
  • Institution:Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-16])

During THP-1 Monocyte Differentiation Into Macrophages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[9] b-actin

PMA-induced THP-1 monocyte-to-macrophage differentiation

NM_001101
  • F:ATTGCCGACAGGATGCAGAA
  • R:GCTGATCCACATCTGCTGGAA
150 60 SYBR
RPL37A[9] ribosomal protein L37a

PMA-induced THP-2 monocyte-to-macrophage differentiation

NM_000998.4
  • F:ATTGAAATCAGCCAGCACGC
  • R:AGGAACCACAGTGCCAGATCC
94 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Stefan Lorkowski
  • Email:stefan.lorkowski@uni-jena.de
  • Institution:Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany

Citation Statistics

Cited by 46 (Based on Google Scholar [2017-06-16])

Serous Ovarian Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GUSB[10] Beta-glucuronidase

serous ovarian cancer

NM_000181
  • F:AGCCAGTTCCTCATCAATGG
  • R:GGTAGTGGCTGGTACGGAAA
160 60 or 63 SYBR
PPIA[10] Peptidylprolyl isomerase A

serous ovarian cancer

NM_021130
  • F:AGACAAGGTCCCAAAGAC
  • R:ACCACCCTGACACATAAA
118 61 or 63 SYBR
TBP[10] TATA box binding protein

serous ovarian cancer

NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
132 62 or 63 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Xing Xie
  • Email:xiex@mail.hz.zj.cn
  • Institution:Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2, *Institution:Hangzhou 310006, China

Citation Statistics

Cited by 78 (Based on Google Scholar [2017-06-16])

Normal Thyroid and Goiter Tissue

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[11] Beta-actin

normal thyroid and goiter tissues

NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAATGCA
140 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Tania Weber Furlanetto
  • Email:taniafurlanetto@gmail.com
  • Institute:UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-16])

Colonic and Vaginal Epithelial Cell Lines

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PGK1[12] phosphoglycerate kinase 1

HT-29 cells

NM_000291
  • F:GAGATGATTATTGGTGGTGGAA
  • R:AGTCAACAGGCAAGGTAATC
NA 60 SYBR
RPLP0[12] ribosomal protein large P0

VK2/E6E7 cells

NM_001002
  • F:ACAATGGCAGCATCTACA
  • R:GTAATCCGTCTCCACAGA
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Nikolai Scherbak
  • Email:nikolai.scherbak@oru.se
  • Institution:School of Science and Technology, Sweden

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-16])

Myocardium

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SRP14[13] Signal recognition particle 14 kDa

myocardium

NM_003134
  • F:CAGATGGCTTATTCAAACCTCCT
  • R:ATGCCCTTTACTGTGCTGCT
181 60~61 SYBR
TPT1[13] translationally-controlled 1

myocardium

NM_003295
  • F:AAATGTTAACAAATGTGGCAATTAT
  • R:AACAATGCCTCCACTCCAAA
164 58~61 SYBR
EEF1A1[13] eukaryotic elongation factor 1A1

myocardium

NM_015905
  • F:CTTTGGGTCGCTTTGCTGTT
  • R:CCGTTCTTCCACCACTGATT
183 60~63 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Vicky A Cameron
  • Email:vicky.cameron@otago.ac.nz
  • Institution: Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand

Breast Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[14] Beta actin

breast cancer samples

NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAACGCA
140 64 SYBR
RPS23[14] 40S ribosomal protein S23

breast cancer samples

NM_001025
  • F:CGGTGCTTCTCTCTTTCGCT
  • R:ATGCCACTTCTGGTCTCGT
110 64 SYBR
HUWE1[14] E3 ubiquitin-protein ligase HUWE1

breast cancer samples

NM_031407
  • F:CAGAGTTGGACAGAGTGAAA
  • R:TACACAGAGAGAGGAGGACA
137 64 SYBR
EEF1A1[14] Elongation factor 1-alpha 1

breast cancer samples

NM_001402
  • F:TGAAAACTACCCCTAAAAGCCA
  • R: TATCCAAGACCCAGGCATACT
208 64 SYBR
SF3A1[14] Splicing factor 3 subunit 1

breast cancer samples

NM_005877
  • F:AAGGGTCCAGTGTCCATCAAAGT
  • R:GCCATGTTGTAGTAAGCCAGTGAG
224 64 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Alexander G Tonevitsky
  • Email:d.maltseva@bioclinicum.com
  • Institution:SRC Bioclinicum, Moscow, Russia

Prostate Cancer Cells

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[15] glyceraldehyde-3-phosphate dehydrogenase

prostate cancer cells

NM_002046
  • F:CTTTGTCAAGCTCATTTCCTGG
  • R:TCTTCCTCTTGTGCTCTTGC
133 NA SYBR
SDHA[15] succinate dehydrogenase complex, subunit A, flavoprotein(Fp)

prostate cancer cells

NM_004168
  • F:TGGTTGTCTTTGGTCGGG
  • R:GCGTTTGGTTTAATTGGAGGG
85 NA SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Gisele Branchini
  • Email:giseleb@ufcspa.edu.br
  • Institution: Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil

Stomach Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[16] Beta-2-microglobulin

stomach cancer cell lines;all stomach tissues

NM_004048
  • F:ACTGAATTCACCCCCACTGA
  • R:CCTCCATGATGCTGCTTACA
114 58 SYBR
GAPDH[16] Ribosomal protein L29

stomach cancer cell lines

NM_002046
  • F:TGCACCACCAACTGCTTA
  • R:GGATGCAGGGATGATGTTC
177 58 SYBR
RPL29[16] Ribosomal protein L29

all stomach tissues

NM_000992
  • F:GGCGTTGTTGACCCTATTTC
  • R:GTGTGTGGTGTGGTTCTTGG
120 58 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Sung-Ho Goh
  • Email:andrea@ncc.re.kr
  • Institution:Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea

Endometrioid Endometrial Carcinoma Tissues

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PPIA[17] Peptidylprolyl isomerase A (Cyclophilin A)
  • endometrial tumor samples at different tumor degrees
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
NM_021130
  • F: gaggaaaaccgtgtactattagc
  • R:gggaccttgtctgcaaac
113 60 SYBR
HPRT1[17] Hypoxanthine phosphoribosyltransferase 1
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
NM_000194
  • F:ctggaaagaatgtcttgattgtg
  • R: gaccttgaccatctttggatta
104 60 SYBR
GAPDH[17] Glyceraldehyde-3-phosphate dehydrogenase
  • endometrioid endometrial cancer samples
NM_002046
  • F:cccttcattgacctcaactacatg
  • R: tgggatttccattgatgacaagc
115 60 SYBR
H3F3A[17] H3 histone, family 3A
  • endometrioid endometrial cancer samples
NM_002107
  • F: tgctcaggactttaaaacaga
  • R: cacaggttggtgtcttcaa
108 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Eliana Bignotti
  • Email:cromani76@gmail.com
  • Institution:Angelo Nocivelli Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,

Epicardial Adipose Tissue

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CYCA[18] Peptidylprolyl isomerase A

human epicardial adipose tissue

NM_021130
  • F:ATCCTAGAGGTGGCGGATTT
  • R:CACTCAGGTCTGAGCCACAA
NA NA SYBR
GAPDH[18] Glycerladehyde 3-phosphate dehydrogenase

human epicardial adipose tissue

NM_002046
  • F:ATGTTCGTCATGGGTGTGAA
  • R:GGTGCTAAGCAGTTGGTGGT
NA NA SYBR
RPL27[18] Ribosomal protein L27

human epicardial adipose tissue

NM_000988
  • F: GTGAAAGTGTATAACTACAATCACC
  • R: TCAAACTTGACCTTGGCCT
NA NA SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Denis Richard
  • Email:Denis.Richard@criucpq.ulaval.ca
  • Institution:Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada

Umbilical Vein Endothelial Cells on Substrates with Different Stiffness

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SDHA[19] Succinate dehydrogenase complex, subunit A

Cartilage Endplate of the Lumbar Spine

NM_004168
  • F:agacctaaagcacctgaagacg
  • R:atcaatccgcaccttgtagtct
175 60 SYBR
B2M[19] Beta-2-microglobulin

Cartilage Endplate of the Lumbar Spine

NM_004048
  • F:atccatccgacattgaagttg
  • R:ggcaggcatactcatctttttc
150 60 SYBR
LDHA[19] Lactate dehydrogenase A

Cartilage Endplate of the Lumbar Spine

NM_005566
  • F:gcctgtatggagtggaatgaa
  • R:ccaggatgtgtagcctttgag
157 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Shun-Wu Fan
  • Email:zzj-0708@163.com
  • Institution:Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China

Head and Neck Squamous Cell Carcinoma

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[20] glyceraldehyde-3-phosphate dehydrogenase
  • head and neck squamous cell carcinoma
NM_002046
  • F:tgaacgggaagctcactgg
  • R:tccaccaccctgttgctgta
307 60 SYBR
SDHA[20] succinate dehydrogenase complex, subunit A, flavoprotein
  • head and neck squamous cell carcinoma
NM_004168
  • F:agcaagctctatggagacct
  • R:taatcgtactcatcaatccg
200 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Jean-Paul Brouillet
  • Email:jpbrouillet@gmail.com
  • Institution:Centre National de la Recherche Scientifique, Montpellier F-34094, France

Cartilage Endplate of the Lumbar Spine

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PPIA[21] peptidylprolyl isomerase A (cyclophilin A)

ccRCC tissues

NM_021130
  • F:ACCGCCGAGGAAAACCGTGTA
  • R:TGCTGTCTTTGGGACCTTGTCTGC
129 60 SYBR
RPS13[21] ribosomal protein S13

ccRCC tissues

NM_001017
  • F:TCGGCTTTACCCTATCGACGCAG
  • R:ACGTACTTGTGCAACACCATGTGA
153 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Christophe E Pierreux
  • Email:christophe.pierreux@uclouvain.be
  • Institution:CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium

Osteoarthritic Articular Cartilage

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer PCR Size (bp) Tm Detection
TBP[22] TATA-box binding protein
  • articular cartilage
NM_003194
  • F: 5-tgcacaggagccaagagtgaa-3
  • R: 5-cacatcacagctccccacca-3
132 56 ℃  SYBR
RPL13A[22] polymerase II large subunit
  • articular cartilage
NM_012423
  • F: 5-aaaaagcggatggtggttc-3
  • R: 5-cttccggtagtggatcttgg-3
168 56 ℃  SYBR
B2M[22] polymerase II large subunit
  • articular cartilage
NM_004048
  • F: 5-atgagtatgcctgccgtgtga-3
  • R: 5-ggcatcttcaaacctccatg-3
101 56 ℃  SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Antonio Gonzalez
  • Email: Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
  • Institution: Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain

Hepatocellular Carcinoma

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
HMBS[23] hydroxymethylbilane synthase
  • Universial reference gene for gene expression studies in HCC
NM_000190.3
  • F: 5-TGCAACGGCGGAAGAAAA-3
  • R: 5-ACGAGGCTTTCAATGTTGCC-3
113 56.4 SYBR
GAPDH[23] Glyceraldehyde-3-phosphate dehydrogenase
  • between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC
  • among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
NM_012423
  • F: 5-TGCACCACCAACTGCTTAGC-3
  • R: 5-GGCATGGACTGTGGTCATGAG-3
87 56.4 SYBR
UBC[23] ubiquitin C
  • for tumor tissues
NM_021009.3
  • F: 5-CGGTGAACGCCGATGATTAT-3
  • R: 5-ATCTGCATTGTCAAGTGACGA-3
124 56.4 SYBR
SDHA[23] succinate dehydrogenase complex, subunit A
  • for five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
NM_004168.2
  • F: 5-TGGGAACAAGAGGGC ATCTG-3
  • R: 5-CCACCACTGCATCAAATTCATG-3
86 56.4 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Susanne Beckebaum
  • Email: Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
  • Institution: susanne.beckebaum@uni-due.de

References

  1. 1.0 1.1 Mehta R, Birerdinc A, Hossain N, et al. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples[J]. BMC Molecular Biology, 2010, 11(1): 39.
  2. 2.0 2.1 2.2 Vázquez-Blomquist D, Fernández J R, Miranda J, et al. Selection of reference genes for use in quantitative reverse transcription PCR assays when using interferons in U87MG[J]. Molecular biology reports, 2012, 39(12): 11167-11175.
  3. 3.0 3.1 3.2 Ali H, Du Z, Li X, et al. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro[J]. Molecular medicine reports, 2015, 11(5): 3767-3773.
  4. 4.0 4.1 Tratwal J, Follin B, Ekblond A, Kastrup J, Haack-Sørensen M. Identification of a common reference gene pair for qPCR in human mesenchymal stromal cells from different tissue sources treated with VEGF. BMC Mol Biol. 2014 May 28;15:11. doi: 10.1186/1471-2199-15-11. PubMed PMID: 24885696; PubMed Central PMCID: PMC4045907.
  5. 5.0 5.1 5.2 Grube S, Göttig T, Freitag D, Ewald C, Kalff R, Walter J. Selection of suitable reference genes for expression analysis in human glioma using RT-qPCR. J Neurooncol. 2015 May;123(1):35-42. doi: 10.1007/s11060-015-1772-7. Epub 2015 Apr 11. PubMed PMID: 25862007.
  6. 6.0 6.1 6.2 Wierzbicki P M, Klacz J, Rybarczyk A, et al. Identification of a suitable qPCR reference gene in metastatic clear cell renal cell carcinoma[J]. Tumor Biology, 2014, 35(12): 12473-12487.
  7. 7.0 7.1 7.2 Vossaert L, O’Leary T, Van Neste C, et al. Reference loci for RT-qPCR analysis of differentiating human embryonic stem cells[J]. BMC molecular biology, 2013, 14(1): 21.
  8. 8.0 8.1 8.2 Chen G, Zhao L, Feng J, et al. Validation of reliable reference genes for real-time PCR in human umbilical vein endothelial cells on substrates with different stiffness[J]. PLoS One, 2013, 8(6): e67360.
  9. 9.0 9.1 Maeß M B, Sendelbach S, Lorkowski S. Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages[J]. BMC molecular biology, 2010, 11(1): 90.
  10. 10.0 10.1 10.2 Li Y L, Ye F, Hu Y, et al. Identification of suitable reference genes for gene expression studies of human serous ovarian cancer by real-time polymerase chain reaction[J]. Analytical biochemistry, 2009, 394(1): 110-116.
  11. Weber R, Bertoni A P S, Bessestil L W, et al. Validation of reference genes for normalization gene expression in reverse transcription quantitative PCR in human normal thyroid and goiter tissue[J]. BioMed research international, 2014, 2014.
  12. 12.0 12.1 Jacobsen A V, Yemaneab B T, Jass J, et al. Reference gene selection for qPCR Is dependent on cell type rather than treatment in colonic and vaginal human epithelial cell lines[J]. PloS one, 2014, 9(12): e115592.
  13. 13.0 13.1 13.2 Pilbrow A P, Ellmers L J, Black M A, et al. Genomic selection of reference genes for real-time PCR in human myocardium[J]. BMC medical genomics, 2008, 1(1): 64.
  14. 14.0 14.1 14.2 14.3 14.4 Maltseva D V, Khaustova N A, Fedotov N N, et al. High-throughput identification of reference genes for research and clinical RT-qPCR analysis of breast cancer samples[J]. Journal of clinical bioinformatics, 2013, 3(1): 13.
  15. 15.0 15.1 Souza A F D, Brum I S, Neto B S, et al. Reference gene for primary culture of prostate cancer cells[J]. Molecular biology reports, 2013, 40(4): 2955-2962.
  16. 16.0 16.1 16.2 Rho H W, Lee B C, Choi E S, et al. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR[J]. BMC cancer, 2010, 10(1): 240.
  17. 17.0 17.1 17.2 17.3 Romani C, Calza S, Todeschini P, et al. Identification of optimal reference genes for gene expression normalization in a wide cohort of endometrioid endometrial carcinoma tissues[J]. PloS one, 2014, 9(12): e113781.
  18. 18.0 18.1 18.2 Chechi K, Gelinas Y, Mathieu P, et al. Validation of reference genes for the relative quantification of gene expression in human epicardial adipose tissue[J]. PloS one, 2012, 7(4): e32265.
  19. 19.0 19.1 19.2 Zhou Z J, Zhang J F, Xia P, et al. Selection of suitable reference genes for normalization of quantitative real-time polymerase chain reaction in human cartilage endplate of the lumbar spine[J]. PLoS One, 2014, 9(2): e88892.
  20. 20.0 20.1 Lallemant B, Evrard A, Combescure C, et al. Reference gene selection for head and neck squamous cell carcinoma gene expression studies[J]. BMC Molecular Biology, 2009, 10(1): 78.
  21. 21.0 21.1 Dupasquier S, Delmarcelle A S, Marbaix E, et al. Validation of housekeeping gene and impact on normalized gene expression in clear cell renal cell carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression[J]. BMC molecular biology, 2014, 15(1): 9.
  22. 22.0 22.1 22.2 Pombo-Suarez M, Calaza M, Gomez-Reino J J, et al. Reference genes for normalization of gene expression studies in human osteoarthritic articular cartilage[J]. BMC molecular biology, 2008, 9(1): 17.
  23. 23.0 23.1 23.2 23.3 Cicinnati V R, Shen Q, Sotiropoulos G C, et al. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR[J]. BMC cancer, 2008, 8(1): 350.