Difference between revisions of "Homo sapiens"

From ICG
Jump to navigation Jump to search
Line 1,029: Line 1,029:
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
! Gene symbol  
! Gene Symbol  
! Gene name
! Gene Name
! style="width=25% font-size:9pt "|Application Scope  
! style="width=25% font-size:9pt "|Application Scope  
! Accession Number  
! Accession Number  
Line 1,074: Line 1,074:
|align="center"| SYBR
|align="center"| SYBR
===Moleculer types===
===Moleculer Types===
* mRNA
* mRNA
===Evaluation Methods===  
===Evaluation Methods===  
Line 1,085: Line 1,085:
*'''Institution''':Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada
*'''Institution''':Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada
===Citation Statistics===
Cited by '''28''' (Based on Google Scholar [2017-06-16])
=='''Umbilical Vein Endothelial Cells on Substrates with Different Stiffness'''==
=='''Umbilical Vein Endothelial Cells on Substrates with Different Stiffness'''==

Revision as of 09:40, 16 June 2017


Bisceral Adipose Samples

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[1] β-Actin

visceral adipose samples

NA 55 EvaGreen
RPII [1] RNA polymerase II

visceral adipose samples

NA 60 EvaGreen

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Ancha Baranova
  • Email: abaranov@gmu.edu
  • Institution:Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA

Citation Statistics

Cited by 73 (Based on Google Scholar [2017-06-01])

Using Interferons in U87MG

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
DDX5[2] RNA helicase


125 60 SYBR
GAPDH[2] glyceraldehyde-3-phosphate dehydrogenase


138 60 SYBR
HMBS[2] hydroxymethylbilane synthase


150 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Iraldo Bello
  • Email:dania.vazquez@cigb.edu.cu
  • Institution:Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Lung Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[3] β -actin

lung cancer cell lines

111 58 SYBR
PPIA[3] Peptidylprolyl isomerase A, cydophilin A, romatase A

lung cancer cell lines

179 58 SYBR
PGK1[3] Phosphoglycerate kinase-1

lung cancer cell lines

102 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Email:zhanguizhenjlu@163.com
  • Institution:Department of Central Laboratory, Second Hospital, Jilin University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Mesenchymal Stromal Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TBP[4] TATA-binding protein
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells
YWHAZ[4] tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Mandana Haack
  • Email:Mandana.Haack-Soerensen@regionh.dk
  • Institution:Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])


Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[5] Glyceraldehyde-3-phosphate dehydrogenase
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
222 55 SYBR
RPL13A[5] Ribosomal protein L13a
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
126 55 SYBR
CYC1[5] Cytochrome c-1
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
160 55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Susanne Grube
  • Email:susanne.grube@med.uni-jena.de
  • Institution:Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-01])

Metastatic Clear Cell Renal Cell Carcinoma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL13[6] Ribosomal protein L13
  • 35 primary tumor nonmetastatic versus 35 mccRCC samples and matched metastasized T/C/M samples
164 59 Sybr
GUSB[6] Glucuronidase, beta
  • total 152 samples and in paired Tand C(n=140) kidney samples
177 59 Sybr
RPLP0[6] Ribosomal protein, large, P0
  • matchedtumor-control-metastasized ccRCC samples
307 58.5 Sybr

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Zbigniew Kmiec
  • Email: pwierzb@gumed.edu.pl
  • Institution:Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. D?binki 1, PL 80-211 Gda��sk, Poland

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-06-01])

Differentiating Human Embryonic Stem Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[7] beta-2-microglobulin

differentiating human embryonic stem cells

86 60 SYBR
RPL13A[7] ribosomal protein L13A

differentiating human embryonic stem cells

126 60 SYBR
AluSq [7] Alu repeats, subfamily Sq

differentiating human embryonic stem cells


Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Dieter Deforce
  • Email:Dieter.Deforce@UGent.be
  • Institution:Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])

Umbilical Vein Endothelial Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[8] Beta-2-microglobulin

human umbilical vein endothelial cells on substrates with different stiffness

106 59 SYBR
HPRT-1[8] Hypoxanthine phosphoribosyl-transferase 1

human umbilical vein endothelial cells on substrates with different stiffness

195 59 SYBR
YWHAZ[8] Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide

human umbilical vein endothelial cells on substrates with different stiffness

94 59 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Hong Zhou
  • Email:zhouhtt1966@163.com
  • Institution:Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-16])

During THP-1 Monocyte Differentiation Into Macrophages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[9] b-actin

PMA-induced THP-1 monocyte-to-macrophage differentiation

150 60 SYBR
RPL37A[9] ribosomal protein L37a

PMA-induced THP-2 monocyte-to-macrophage differentiation

94 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Stefan Lorkowski
  • Email:stefan.lorkowski@uni-jena.de
  • Institution:Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany

Citation Statistics

Cited by 46 (Based on Google Scholar [2017-06-16])

Serous Ovarian Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GUSB[10] Beta-glucuronidase

serous ovarian cancer

160 60 or 63 SYBR
PPIA[10] Peptidylprolyl isomerase A

serous ovarian cancer

118 61 or 63 SYBR
TBP[10] TATA box binding protein

serous ovarian cancer

132 62 or 63 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Xing Xie
  • Email:xiex@mail.hz.zj.cn
  • Institution:Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2, *Institution:Hangzhou 310006, China

Citation Statistics

Cited by 78 (Based on Google Scholar [2017-06-16])

Normal Thyroid and Goiter Tissue

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[11] Beta-actin

normal thyroid and goiter tissues

140 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Tania Weber Furlanetto
  • Email:taniafurlanetto@gmail.com
  • Institute:UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-16])

Colonic and Vaginal Epithelial Cell Lines

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PGK1[12] phosphoglycerate kinase 1

HT-29 cells

RPLP0[12] ribosomal protein large P0

VK2/E6E7 cells


Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Nikolai Scherbak
  • Email:nikolai.scherbak@oru.se
  • Institution:School of Science and Technology, Sweden

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-16])


Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SRP14[13] Signal recognition particle 14 kDa


181 60~61 SYBR
TPT1[13] translationally-controlled 1


164 58~61 SYBR
EEF1A1[13] eukaryotic elongation factor 1A1


183 60~63 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Vicky A Cameron
  • Email:vicky.cameron@otago.ac.nz
  • Institution: Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-06-16])

Breast Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[14] Beta actin

breast cancer samples

140 64 SYBR
RPS23[14] 40S ribosomal protein S23

breast cancer samples

110 64 SYBR
HUWE1[14] E3 ubiquitin-protein ligase HUWE1

breast cancer samples

137 64 SYBR
EEF1A1[14] Elongation factor 1-alpha 1

breast cancer samples

208 64 SYBR
SF3A1[14] Splicing factor 3 subunit 1

breast cancer samples

224 64 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Alexander G Tonevitsky
  • Email:d.maltseva@bioclinicum.com
  • Institution:SRC Bioclinicum, Moscow, Russia

Citation Statistics

Cited by 36 (Based on Google Scholar [2017-06-16])

Prostate Cancer Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[15] glyceraldehyde-3-phosphate dehydrogenase

prostate cancer cells

SDHA[15] succinate dehydrogenase complex, subunit A, flavoprotein(Fp)

prostate cancer cells


Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Gisele Branchini
  • Email:giseleb@ufcspa.edu.br
  • Institution: Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-06-16])

Stomach Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[16] Beta-2-microglobulin

stomach cancer cell lines;all stomach tissues

114 58 SYBR
GAPDH[16] Ribosomal protein L29

stomach cancer cell lines

177 58 SYBR
RPL29[16] Ribosomal protein L29

all stomach tissues

120 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Sung-Ho Goh
  • Email:andrea@ncc.re.kr
  • Institution:Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea

Citation Statistics

Cited by 55 (Based on Google Scholar [2017-06-16])

Endometrioid Endometrial Carcinoma Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PPIA[17] Peptidylprolyl isomerase A (Cyclophilin A)
  • endometrial tumor samples at different tumor degrees
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
  • F: gaggaaaaccgtgtactattagc
  • R:gggaccttgtctgcaaac
113 60 SYBR
HPRT1[17] Hypoxanthine phosphoribosyltransferase 1
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
  • F:ctggaaagaatgtcttgattgtg
  • R: gaccttgaccatctttggatta
104 60 SYBR
GAPDH[17] Glyceraldehyde-3-phosphate dehydrogenase
  • endometrioid endometrial cancer samples
  • F:cccttcattgacctcaactacatg
  • R: tgggatttccattgatgacaagc
115 60 SYBR
H3F3A[17] H3 histone, family 3A
  • endometrioid endometrial cancer samples
  • F: tgctcaggactttaaaacaga
  • R: cacaggttggtgtcttcaa
108 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Eliana Bignotti
  • Email:cromani76@gmail.com
  • Institution:Angelo Nocivelli Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-16])

Epicardial Adipose Tissue

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CYCA[18] Peptidylprolyl isomerase A

human epicardial adipose tissue

GAPDH[18] Glycerladehyde 3-phosphate dehydrogenase

human epicardial adipose tissue

RPL27[18] Ribosomal protein L27

human epicardial adipose tissue


Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Denis Richard
  • Email:Denis.Richard@criucpq.ulaval.ca
  • Institution:Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-06-16])

Umbilical Vein Endothelial Cells on Substrates with Different Stiffness

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SDHA[19] Succinate dehydrogenase complex, subunit A

Cartilage Endplate of the Lumbar Spine

  • F:agacctaaagcacctgaagacg
  • R:atcaatccgcaccttgtagtct
175 60 SYBR
B2M[19] Beta-2-microglobulin

Cartilage Endplate of the Lumbar Spine

  • F:atccatccgacattgaagttg
  • R:ggcaggcatactcatctttttc
150 60 SYBR
LDHA[19] Lactate dehydrogenase A

Cartilage Endplate of the Lumbar Spine

  • F:gcctgtatggagtggaatgaa
  • R:ccaggatgtgtagcctttgag
157 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Shun-Wu Fan
  • Email:zzj-0708@163.com
  • Institution:Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China

Head and Neck Squamous Cell Carcinoma

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[20] glyceraldehyde-3-phosphate dehydrogenase
  • head and neck squamous cell carcinoma
  • F:tgaacgggaagctcactgg
  • R:tccaccaccctgttgctgta
307 60 SYBR
SDHA[20] succinate dehydrogenase complex, subunit A, flavoprotein
  • head and neck squamous cell carcinoma
  • F:agcaagctctatggagacct
  • R:taatcgtactcatcaatccg
200 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Jean-Paul Brouillet
  • Email:jpbrouillet@gmail.com
  • Institution:Centre National de la Recherche Scientifique, Montpellier F-34094, France

Cartilage Endplate of the Lumbar Spine

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PPIA[21] peptidylprolyl isomerase A (cyclophilin A)

ccRCC tissues

129 60 SYBR
RPS13[21] ribosomal protein S13

ccRCC tissues

153 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Christophe E Pierreux
  • Email:christophe.pierreux@uclouvain.be
  • Institution:CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium

Osteoarthritic Articular Cartilage

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer PCR Size (bp) Tm Detection
TBP[22] TATA-box binding protein
  • articular cartilage
  • F: 5-tgcacaggagccaagagtgaa-3
  • R: 5-cacatcacagctccccacca-3
132 56 ℃  SYBR
RPL13A[22] polymerase II large subunit
  • articular cartilage
  • F: 5-aaaaagcggatggtggttc-3
  • R: 5-cttccggtagtggatcttgg-3
168 56 ℃  SYBR
B2M[22] polymerase II large subunit
  • articular cartilage
  • F: 5-atgagtatgcctgccgtgtga-3
  • R: 5-ggcatcttcaaacctccatg-3
101 56 ℃  SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name: Antonio Gonzalez
  • Email: Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
  • Institution: Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain

Hepatocellular Carcinoma

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
HMBS[23] hydroxymethylbilane synthase
  • Universial reference gene for gene expression studies in HCC
113 56.4 SYBR
GAPDH[23] Glyceraldehyde-3-phosphate dehydrogenase
  • between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC
  • among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
87 56.4 SYBR
UBC[23] ubiquitin C
  • for tumor tissues
124 56.4 SYBR
SDHA[23] succinate dehydrogenase complex, subunit A
  • for five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
86 56.4 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name: Susanne Beckebaum
  • Email: Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
  • Institution: susanne.beckebaum@uni-due.de


  1. 1.0 1.1 Mehta R, Birerdinc A, Hossain N, et al. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples[J]. BMC Molecular Biology, 2010, 11(1): 39.
  2. 2.0 2.1 2.2 Vázquez-Blomquist D, Fernández J R, Miranda J, et al. Selection of reference genes for use in quantitative reverse transcription PCR assays when using interferons in U87MG[J]. Molecular biology reports, 2012, 39(12): 11167-11175.
  3. 3.0 3.1 3.2 Ali H, Du Z, Li X, et al. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro[J]. Molecular medicine reports, 2015, 11(5): 3767-3773.
  4. 4.0 4.1 Tratwal J, Follin B, Ekblond A, Kastrup J, Haack-Sørensen M. Identification of a common reference gene pair for qPCR in human mesenchymal stromal cells from different tissue sources treated with VEGF. BMC Mol Biol. 2014 May 28;15:11. doi: 10.1186/1471-2199-15-11. PubMed PMID: 24885696; PubMed Central PMCID: PMC4045907.
  5. 5.0 5.1 5.2 Grube S, Göttig T, Freitag D, Ewald C, Kalff R, Walter J. Selection of suitable reference genes for expression analysis in human glioma using RT-qPCR. J Neurooncol. 2015 May;123(1):35-42. doi: 10.1007/s11060-015-1772-7. Epub 2015 Apr 11. PubMed PMID: 25862007.
  6. 6.0 6.1 6.2 Wierzbicki P M, Klacz J, Rybarczyk A, et al. Identification of a suitable qPCR reference gene in metastatic clear cell renal cell carcinoma[J]. Tumor Biology, 2014, 35(12): 12473-12487.
  7. 7.0 7.1 7.2 Vossaert L, O’Leary T, Van Neste C, et al. Reference loci for RT-qPCR analysis of differentiating human embryonic stem cells[J]. BMC molecular biology, 2013, 14(1): 21.
  8. 8.0 8.1 8.2 Chen G, Zhao L, Feng J, et al. Validation of reliable reference genes for real-time PCR in human umbilical vein endothelial cells on substrates with different stiffness[J]. PLoS One, 2013, 8(6): e67360.
  9. 9.0 9.1 Maeß M B, Sendelbach S, Lorkowski S. Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages[J]. BMC molecular biology, 2010, 11(1): 90.
  10. 10.0 10.1 10.2 Li Y L, Ye F, Hu Y, et al. Identification of suitable reference genes for gene expression studies of human serous ovarian cancer by real-time polymerase chain reaction[J]. Analytical biochemistry, 2009, 394(1): 110-116.
  11. Weber R, Bertoni A P S, Bessestil L W, et al. Validation of reference genes for normalization gene expression in reverse transcription quantitative PCR in human normal thyroid and goiter tissue[J]. BioMed research international, 2014, 2014.
  12. 12.0 12.1 Jacobsen A V, Yemaneab B T, Jass J, et al. Reference gene selection for qPCR Is dependent on cell type rather than treatment in colonic and vaginal human epithelial cell lines[J]. PloS one, 2014, 9(12): e115592.
  13. 13.0 13.1 13.2 Pilbrow A P, Ellmers L J, Black M A, et al. Genomic selection of reference genes for real-time PCR in human myocardium[J]. BMC medical genomics, 2008, 1(1): 64.
  14. 14.0 14.1 14.2 14.3 14.4 Maltseva D V, Khaustova N A, Fedotov N N, et al. High-throughput identification of reference genes for research and clinical RT-qPCR analysis of breast cancer samples[J]. Journal of clinical bioinformatics, 2013, 3(1): 13.
  15. 15.0 15.1 Souza A F D, Brum I S, Neto B S, et al. Reference gene for primary culture of prostate cancer cells[J]. Molecular biology reports, 2013, 40(4): 2955-2962.
  16. 16.0 16.1 16.2 Rho H W, Lee B C, Choi E S, et al. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR[J]. BMC cancer, 2010, 10(1): 240.
  17. 17.0 17.1 17.2 17.3 Romani C, Calza S, Todeschini P, et al. Identification of optimal reference genes for gene expression normalization in a wide cohort of endometrioid endometrial carcinoma tissues[J]. PloS one, 2014, 9(12): e113781.
  18. 18.0 18.1 18.2 Chechi K, Gelinas Y, Mathieu P, et al. Validation of reference genes for the relative quantification of gene expression in human epicardial adipose tissue[J]. PloS one, 2012, 7(4): e32265.
  19. 19.0 19.1 19.2 Zhou Z J, Zhang J F, Xia P, et al. Selection of suitable reference genes for normalization of quantitative real-time polymerase chain reaction in human cartilage endplate of the lumbar spine[J]. PLoS One, 2014, 9(2): e88892.
  20. 20.0 20.1 Lallemant B, Evrard A, Combescure C, et al. Reference gene selection for head and neck squamous cell carcinoma gene expression studies[J]. BMC Molecular Biology, 2009, 10(1): 78.
  21. 21.0 21.1 Dupasquier S, Delmarcelle A S, Marbaix E, et al. Validation of housekeeping gene and impact on normalized gene expression in clear cell renal cell carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression[J]. BMC molecular biology, 2014, 15(1): 9.
  22. 22.0 22.1 22.2 Pombo-Suarez M, Calaza M, Gomez-Reino J J, et al. Reference genes for normalization of gene expression studies in human osteoarthritic articular cartilage[J]. BMC molecular biology, 2008, 9(1): 17.
  23. 23.0 23.1 23.2 23.3 Cicinnati V R, Shen Q, Sotiropoulos G C, et al. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR[J]. BMC cancer, 2008, 8(1): 350.