Homo sapiens

From ICG
Jump to navigation Jump to search


Bisceral Adipose Samples

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[1] β-Actin

visceral adipose samples

NA 55 EvaGreen
RPII [1] RNA polymerase II

visceral adipose samples

NA 60 EvaGreen

Moleculer Types

  • mRNA

Evaluation Methods


  • Name: Ancha Baranova
  • Email: abaranov@gmu.edu
  • Institution:Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA

Citation Statistics

Cited by 73 (Based on Google Scholar [2017-06-01])

Using Interferons in U87MG

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
DDX5[2] RNA helicase


125 60 SYBR
GAPDH[2] glyceraldehyde-3-phosphate dehydrogenase


138 60 SYBR
HMBS[2] hydroxymethylbilane synthase


150 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Iraldo Bello
  • Email:dania.vazquez@cigb.edu.cu
  • Institution:Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Lung Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[3] β -actin

lung cancer cell lines

111 58 SYBR
PPIA[3] Peptidylprolyl isomerase A, cydophilin A, romatase A

lung cancer cell lines

179 58 SYBR
PGK1[3] Phosphoglycerate kinase-1

lung cancer cell lines

102 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Email:zhanguizhenjlu@163.com
  • Institution:Department of Central Laboratory, Second Hospital, Jilin University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Mesenchymal Stromal Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TBP[4] TATA-binding protein
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells
YWHAZ[4] tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Mandana Haack
  • Email:Mandana.Haack-Soerensen@regionh.dk
  • Institution:Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])


Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[5] Glyceraldehyde-3-phosphate dehydrogenase
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
222 55 SYBR
RPL13A[5] Ribosomal protein L13a
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
126 55 SYBR
CYC1[5] Cytochrome c-1
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
160 55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Susanne Grube
  • Email:susanne.grube@med.uni-jena.de
  • Institution:Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-01])

Metastatic Clear Cell Renal Cell Carcinoma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL13[6] Ribosomal protein L13
  • 35 primary tumor nonmetastatic versus 35 mccRCC samples and matched metastasized T/C/M samples
164 59 Sybr
GUSB[6] Glucuronidase, beta
  • total 152 samples and in paired Tand C(n=140) kidney samples
177 59 Sybr
RPLP0[6] Ribosomal protein, large, P0
  • matchedtumor-control-metastasized ccRCC samples
307 58.5 Sybr

Moleculer Types

  • mRNA

Evaluation Methods


  • Name:Zbigniew Kmiec
  • Email: pwierzb@gumed.edu.pl
  • Institution:Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. D?binki 1, PL 80-211 Gda��sk, Poland

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-06-01])

Differentiating Human Embryonic Stem Cells

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[7] beta-2-microglobulin

differentiating human embryonic stem cells

86 60 SYBR
RPL13A[7] ribosomal protein L13A

differentiating human embryonic stem cells

126 60 SYBR
AluSq [7] Alu repeats, subfamily Sq

differentiating human embryonic stem cells


Moleculer types

  • mRNA

Evaluation Methods


  • Name:Dieter Deforce
  • Email:Dieter.Deforce@UGent.be
  • Institution:Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium

Umbilical Vein Endothelial Cells

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[8] Beta-2-microglobulin

human umbilical vein endothelial cells on substrates with different stiffness

106 59 SYBR
HPRT-1[8] Hypoxanthine phosphoribosyl-transferase 1

human umbilical vein endothelial cells on substrates with different stiffness

195 59 SYBR
YWHAZ[8] Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide

human umbilical vein endothelial cells on substrates with different stiffness

94 59 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Hong Zhou
  • Email:zhouhtt1966@163.com
  • Institution:Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China

During THP-1 Monocyte Differentiation Into Macrophages

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[9] b-actin

PMA-induced THP-1 monocyte-to-macrophage differentiation

150 60 SYBR
RPL37A[9] ribosomal protein L37a

PMA-induced THP-2 monocyte-to-macrophage differentiation

94 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Stefan Lorkowski
  • Email:stefan.lorkowski@uni-jena.de
  • Institution:Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany

Serous Ovarian Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GUSB[10] Beta-glucuronidase

serous ovarian cancer

160 60 or 63 SYBR
PPIA[10] Peptidylprolyl isomerase A

serous ovarian cancer

118 61 or 63 SYBR
TBP[10] TATA box binding protein

serous ovarian cancer

132 62 or 63 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Xing Xie
  • Email:xiex@mail.hz.zj.cn
  • Institution:Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2, *Institution:Hangzhou 310006, China

Normal Thyroid and Goiter Tissue

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[11] Beta-actin

normal thyroid and goiter tissues

140 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Tania Weber Furlanetto
  • Email:taniafurlanetto@gmail.com
  • Institute:UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil

Colonic and Vaginal Epithelial Cell Lines

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PGK1[12] phosphoglycerate kinase 1

HT-29 cells

RPLP0[12] ribosomal protein large P0

VK2/E6E7 cells


Moleculer types

  • mRNA

Evaluation Methods


  • Name: Nikolai Scherbak
  • Email:nikolai.scherbak@oru.se
  • Institution:School of Science and Technology, Sweden


Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SRP14[13] Signal recognition particle 14 kDa


181 60~61 SYBR
TPT1[13] translationally-controlled 1


164 58~61 SYBR
EEF1A1[13] eukaryotic elongation factor 1A1


183 60~63 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Vicky A Cameron
  • Email:vicky.cameron@otago.ac.nz
  • Institution: Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand

Breast Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[14] Beta actin

breast cancer samples

140 64 SYBR
RPS23[14] 40S ribosomal protein S23

breast cancer samples

110 64 SYBR
HUWE1[14] E3 ubiquitin-protein ligase HUWE1

breast cancer samples

137 64 SYBR
EEF1A1[14] Elongation factor 1-alpha 1

breast cancer samples

208 64 SYBR
SF3A1[14] Splicing factor 3 subunit 1

breast cancer samples

224 64 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Alexander G Tonevitsky
  • Email:d.maltseva@bioclinicum.com
  • Institution:SRC Bioclinicum, Moscow, Russia

Prostate Cancer Cells

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[15] glyceraldehyde-3-phosphate dehydrogenase

prostate cancer cells

SDHA[15] succinate dehydrogenase complex, subunit A, flavoprotein(Fp)

prostate cancer cells


Moleculer types

  • mRNA

Evaluation Methods


  • Name:Gisele Branchini
  • Email:giseleb@ufcspa.edu.br
  • Institution: Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil

Stomach Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[16] Beta-2-microglobulin

stomach cancer cell lines;all stomach tissues

114 58 SYBR
GAPDH[16] Ribosomal protein L29

stomach cancer cell lines

177 58 SYBR
RPL29[16] Ribosomal protein L29

all stomach tissues

120 58 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Sung-Ho Goh
  • Email:andrea@ncc.re.kr
  • Institution:Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea

Endometrioid Endometrial Carcinoma Tissues

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PPIA[17] Peptidylprolyl isomerase A (Cyclophilin A)
  • endometrial tumor samples at different tumor degrees
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
  • F: gaggaaaaccgtgtactattagc
  • R:gggaccttgtctgcaaac
113 60 SYBR
HPRT1[17] Hypoxanthine phosphoribosyltransferase 1
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
  • F:ctggaaagaatgtcttgattgtg
  • R: gaccttgaccatctttggatta
104 60 SYBR
GAPDH[17] Glyceraldehyde-3-phosphate dehydrogenase
  • endometrioid endometrial cancer samples
  • F:cccttcattgacctcaactacatg
  • R: tgggatttccattgatgacaagc
115 60 SYBR
H3F3A[17] H3 histone, family 3A
  • endometrioid endometrial cancer samples
  • F: tgctcaggactttaaaacaga
  • R: cacaggttggtgtcttcaa
108 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods


  • Name:Eliana Bignotti
  • Email:cromani76@gmail.com
  • Institution:Angelo Nocivelli Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,

Epicardial Adipose Tissue

Reference Genes

Gene symbol Gene name Application Scope