Homo sapiens

From ICG
Revision as of 02:40, 16 June 2017 by Xysj2012 (talk | contribs)
Jump to navigation Jump to search

Contents

Bisceral Adipose Samples

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[1] β-Actin

visceral adipose samples

NM_000937
  • F:CTCTTCCAGCCTTCCTTCCT
  • R:AGCACTGTGTTGGCGTACAG
NA 55 EvaGreen
RPII [1] RNA polymerase II

visceral adipose samples

NM_001102
  • F:CTTCACGGTGCTGGGCATT
  • R:GTGCGGCTGCTTCCATAA
NA 60 EvaGreen

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ancha Baranova
  • Email: abaranov@gmu.edu
  • Institution:Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA

Citation Statistics

Cited by 73 (Based on Google Scholar [2017-06-01])

Using Interferons in U87MG

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
DDX5[2] RNA helicase

U87MG

NM_004396
  • F:TAGAGGTCACAACTGCCCGAAG
  • R:GGCCATCCCTGAGCTTGAATAG
125 60 SYBR
GAPDH[2] glyceraldehyde-3-phosphate dehydrogenase

U87MG

NM_002046
  • F:CCATGGGTGGAATCATATTGGA
  • R:TCAACGGATTTGGTCGTATTGG
138 60 SYBR
HMBS[2] hydroxymethylbilane synthase

U87MG

NM_000190
  • F:GGAATGTTACGAGCAGTGATGC
  • R:CCTGACTGGAGGAGTCTGGAGT
150 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Iraldo Bello
  • Email:dania.vazquez@cigb.edu.cu
  • Institution:Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba

Lung Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[3] β -actin

lung cancer cell lines

NM_000937
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TACTCCTGCTTGCTGATCCA
111 58 SYBR
PPIA[3] Peptidylprolyl isomerase A, cydophilin A, romatase A

lung cancer cell lines

NM_021130
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TGCTGGTCTTGCCATTCCT
179 58 SYBR
PGK1[3] Phosphoglycerate kinase-1

lung cancer cell lines

NM_000291
  • F:GCCACTTGCTGTGCCAAATG
  • R:CCCAGGAAGGACTTTACCTT
102 58 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:GUIZHEN ZHANG
  • Email:zhanguizhenjlu@163.com
  • Institution:Department of Central Laboratory, Second Hospital, Jilin University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China

Mesenchymal Stromal Cells

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TBP[4] TATA-binding protein
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells
NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
NA 60 SYBR
YWHAZ[4] tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells
NM_001135702
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
NA 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Mandana Haack
  • Email:Mandana.Haack-Soerensen@regionh.dk
  • Institution:Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Glioma

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[5] Glyceraldehyde-3-phosphate dehydrogenase
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_002046
  • F:TCGCCAGCCGAGCCACATC
  • R:CGTTCTCAGCCTTGACGGTGC
222 55 SYBR
RPL13A[5] Ribosomal protein L13a
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R: TTGAGGACCTCTGTGTATTTGTCAA
126 55 SYBR
CYC1[5] Cytochrome c-1
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_001916
  • F:GAGGTGGAGGTTCAAGACGG
  • R:TAGCTCGCACGATGTAGCTG
160 55 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Susanne Grube
  • Email:susanne.grube@med.uni-jena.de
  • Institution:Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany

Metastatic Clear Cell Renal Cell Carcinoma

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL13[6] Ribosomal protein L13
  • 35 primary tumor nonmetastatic versus 35 mccRCC samples and matched metastasized T/C/M samples
NM_000977
  • F:TTCCGCTCGGCTGTTTTCCTG
  • R:GGGCCTTACGTCTGCGGATCTTA
164 59 Sybr
GUSB[6] Glucuronidase, beta
  • total 152 samples and in paired Tand C(n=140) kidney samples
NM_000181
  • F:ATGCAGGTGATGGAAGAAGTGGTG
  • R:AGAGTTGCTCACAAAGGTCACAGG
177 59 Sybr
RPLP0[6] Ribosomal protein, large, P0
  • matchedtumor-control-metastasized ccRCC samples
NM_001002
  • F:TAAACCCTGCGTGGCAATCCCTG
  • R:TGAACACAAAGCCCACATTCCCC
307 58.5 Sybr

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Zbigniew Kmiec
  • Email: pwierzb@gumed.edu.pl
  • Institution:Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. D?binki 1, PL 80-211 Gda��sk, Poland

Differentiating Human Embryonic Stem Cells

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[7] beta-2-microglobulin

differentiating human embryonic stem cells

NM_004048
  • F:TGCTGTCTCCATGTTTGATGTATCT
  • R:TCTCTGCTCCCCACCTCTAAGT
86 60 SYBR
RPL13A[7] ribosomal protein L13A

differentiating human embryonic stem cells

NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R:TTGAGGACCTCTGTGTATTTGTCAA
126 60 SYBR
AluSq [7] Alu repeats, subfamily Sq

differentiating human embryonic stem cells

NA
  • F:CATGGTGAAACCCCGTCTCTA
  • R:GCCTCAGCCTCCCGAGTAG
NA 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Dieter Deforce
  • Email:Dieter.Deforce@UGent.be
  • Institution:Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium

Umbilical Vein Endothelial Cells

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[8] Beta-2-microglobulin

human umbilical vein endothelial cells on substrates with different stiffness

NM_004048
  • F:CACCCCCACTGAAAAAGATGAG
  • R:CCTCCATGATGCTGCTTACATG
106 59 SYBR
HPRT-1[8] Hypoxanthine phosphoribosyl-transferase 1

human umbilical vein endothelial cells on substrates with different stiffness

NM_000194
  • F:GACCAGTCAACAGGGGACAT
  • R:AACACTTCGTGGGGTCCTTTTC
195 59 SYBR
YWHAZ[8] Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide

human umbilical vein endothelial cells on substrates with different stiffness

NM_003406
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
94 59 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Hong Zhou
  • Email:zhouhtt1966@163.com
  • Institution:Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China

During THP-1 Monocyte Differentiation Into Macrophages

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[9] b-actin

PMA-induced THP-1 monocyte-to-macrophage differentiation

NM_001101
  • F:ATTGCCGACAGGATGCAGAA
  • R:GCTGATCCACATCTGCTGGAA
150 60 SYBR
RPL37A[9] ribosomal protein L37a

PMA-induced THP-2 monocyte-to-macrophage differentiation

NM_000998.4
  • F:ATTGAAATCAGCCAGCACGC
  • R:AGGAACCACAGTGCCAGATCC
94 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Stefan Lorkowski
  • Email:stefan.lorkowski@uni-jena.de
  • Institution:Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany

Serous Ovarian Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GUSB[10] Beta-glucuronidase

serous ovarian cancer

NM_000181
  • F:AGCCAGTTCCTCATCAATGG
  • R:GGTAGTGGCTGGTACGGAAA
160 60 or 63 SYBR
PPIA[10] Peptidylprolyl isomerase A

serous ovarian cancer

NM_021130
  • F:AGACAAGGTCCCAAAGAC
  • R:ACCACCCTGACACATAAA
118 61 or 63 SYBR
TBP[10] TATA box binding protein

serous ovarian cancer

NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
132 62 or 63 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Xing Xie
  • Email:xiex@mail.hz.zj.cn
  • Institution:Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2, *Institution:Hangzhou 310006, China

Normal Thyroid and Goiter Tissue

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[11] Beta-actin

normal thyroid and goiter tissues

NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAATGCA
140 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Tania Weber Furlanetto
  • Email:taniafurlanetto@gmail.com
  • Institute:UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil

Colonic and Vaginal Epithelial Cell Lines

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PGK1[12] phosphoglycerate kinase 1

HT-29 cells

NM_000291
  • F:GAGATGATTATTGGTGGTGGAA
  • R:AGTCAACAGGCAAGGTAATC
NA 60 SYBR
RPLP0[12] ribosomal protein large P0

VK2/E6E7 cells

NM_001002
  • F:ACAATGGCAGCATCTACA
  • R:GTAATCCGTCTCCACAGA
NA 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Nikolai Scherbak
  • Email:nikolai.scherbak@oru.se
  • Institution:School of Science and Technology, Sweden

Myocardium

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SRP14[13] Signal recognition particle 14 kDa

myocardium

NM_003134
  • F:CAGATGGCTTATTCAAACCTCCT
  • R:ATGCCCTTTACTGTGCTGCT
181 60~61 SYBR
TPT1[13] translationally-controlled 1

myocardium

NM_003295
  • F:AAATGTTAACAAATGTGGCAATTAT
  • R:AACAATGCCTCCACTCCAAA
164 58~61 SYBR
EEF1A1[13] eukaryotic elongation factor 1A1

myocardium

NM_015905
  • F:CTTTGGGTCGCTTTGCTGTT
  • R:CCGTTCTTCCACCACTGATT
183 60~63 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Vicky A Cameron
  • Email:vicky.cameron@otago.ac.nz
  • Institution: Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand

Breast Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[14] Beta actin

breast cancer samples

NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAACGCA
140 64 SYBR
RPS23[14] 40S ribosomal protein S23

breast cancer samples

NM_001025
  • F:CGGTGCTTCTCTCTTTCGCT
  • R:ATGCCACTTCTGGTCTCGT
110 64 SYBR
HUWE1[14] E3 ubiquitin-protein ligase HUWE1

breast cancer samples

NM_031407
  • F:CAGAGTTGGACAGAGTGAAA
  • R:TACACAGAGAGAGGAGGACA
137 64 SYBR
EEF1A1[14] Elongation factor 1-alpha 1

breast cancer samples

NM_001402
  • F:TGAAAACTACCCCTAAAAGCCA
  • R: TATCCAAGACCCAGGCATACT
208 64 SYBR
SF3A1[14] Splicing factor 3 subunit 1

breast cancer samples

NM_005877
  • F:AAGGGTCCAGTGTCCATCAAAGT
  • R:GCCATGTTGTAGTAAGCCAGTGAG
224 64 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Alexander G Tonevitsky
  • Email:d.maltseva@bioclinicum.com
  • Institution:SRC Bioclinicum, Moscow, Russia

Prostate Cancer Cells

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[15] glyceraldehyde-3-phosphate dehydrogenase

prostate cancer cells

NM_002046
  • F:CTTTGTCAAGCTCATTTCCTGG
  • R:TCTTCCTCTTGTGCTCTTGC
133 NA SYBR
SDHA[15] succinate dehydrogenase complex, subunit A, flavoprotein(Fp)

prostate cancer cells

NM_004168
  • F:TGGTTGTCTTTGGTCGGG
  • R:GCGTTTGGTTTAATTGGAGGG
85 NA SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Gisele Branchini
  • Email:giseleb@ufcspa.edu.br
  • Institution: Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil

Stomach Cancer

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[16] Beta-2-microglobulin

stomach cancer cell lines;all stomach tissues

NM_004048
  • F:ACTGAATTCACCCCCACTGA
  • R:CCTCCATGATGCTGCTTACA
114 58 SYBR
GAPDH[16] Ribosomal protein L29

stomach cancer cell lines

NM_002046
  • F:TGCACCACCAACTGCTTA
  • R:GGATGCAGGGATGATGTTC
177 58 SYBR
RPL29[16] Ribosomal protein L29

all stomach tissues

NM_000992
  • F:GGCGTTGTTGACCCTATTTC
  • R:GTGTGTGGTGTGGTTCTTGG
120 58 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Sung-Ho Goh
  • Email:andrea@ncc.re.kr
  • Institution:Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea

Endometrioid Endometrial Carcinoma Tissues

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PPIA[17] Peptidylprolyl isomerase A (Cyclophilin A)
  • endometrial tumor samples at different tumor degrees
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
NM_021130
  • F: gaggaaaaccgtgtactattagc
  • R:gggaccttgtctgcaaac
113 60 SYBR
HPRT1[17] Hypoxanthine phosphoribosyltransferase 1
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
NM_000194
  • F:ctggaaagaatgtcttgattgtg
  • R: gaccttgaccatctttggatta
104 60 SYBR
GAPDH[17] Glyceraldehyde-3-phosphate dehydrogenase
  • endometrioid endometrial cancer samples
NM_002046
  • F:cccttcattgacctcaactacatg
  • R: tgggatttccattgatgacaagc
115 60 SYBR
H3F3A[17] H3 histone, family 3A
  • endometrioid endometrial cancer samples
NM_002107
  • F: tgctcaggactttaaaacaga
  • R: cacaggttggtgtcttcaa
108 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name:Eliana Bignotti
  • Email:cromani76@gmail.com
  • Institution:Angelo Nocivelli Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,

Epicardial Adipose Tissue

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CYCA[18] Peptidylprolyl isomerase A

human epicardial adipose tissue

NM_021130
  • F:ATCCTAGAGGTGGCGGATTT
  • R:CACTCAGGTCTGAGCCACAA
NA NA SYBR
GAPDH[18] Glycerladehyde 3-phosphate dehydrogenase

human epicardial adipose tissue

NM_002046
  • F:ATGTTCGTCATGGGTGTGAA
  • R:GGTGCTAAGCAGTTGGTGGT
NA NA SYBR
RPL27[18] Ribosomal protein L27

human epicardial adipose tissue