Homo sapiens

From ICG
Jump to navigation Jump to search

Contents

Bisceral Adipose Samples

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[1] β-Actin

visceral adipose samples

NM_000937
  • F:CTCTTCCAGCCTTCCTTCCT
  • R:AGCACTGTGTTGGCGTACAG
NA 55 EvaGreen
RPII [1] RNA polymerase II

visceral adipose samples

NM_001102
  • F:CTTCACGGTGCTGGGCATT
  • R:GTGCGGCTGCTTCCATAA
NA 60 EvaGreen

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ancha Baranova
  • Email: abaranov@gmu.edu
  • Institution:Molecular and Microbiology Department and Center for the Study of Genomics in Liver Diseases, George Mason University, Fairfax, VA, USA

Citation Statistics

Cited by 73 (Based on Google Scholar [2017-06-01])

Using Interferons in U87MG

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
DDX5[2] RNA helicase

U87MG

NM_004396
  • F:TAGAGGTCACAACTGCCCGAAG
  • R:GGCCATCCCTGAGCTTGAATAG
125 60 SYBR
GAPDH[2] glyceraldehyde-3-phosphate dehydrogenase

U87MG

NM_002046
  • F:CCATGGGTGGAATCATATTGGA
  • R:TCAACGGATTTGGTCGTATTGG
138 60 SYBR
HMBS[2] hydroxymethylbilane synthase

U87MG

NM_000190
  • F:GGAATGTTACGAGCAGTGATGC
  • R:CCTGACTGGAGGAGTCTGGAGT
150 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Iraldo Bello
  • Email:dania.vazquez@cigb.edu.cu
  • Institution:Department of Genomic, Center for Genetic Engineering and Biotechnology, Ave. 31 e/158 & 190, Playa, 10600 Havana, Cuba

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Lung Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[3] β -actin

lung cancer cell lines

NM_000937
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TACTCCTGCTTGCTGATCCA
111 58 SYBR
PPIA[3] Peptidylprolyl isomerase A, cydophilin A, romatase A

lung cancer cell lines

NM_021130
  • F:GAAGATCAAGATCATTGCTCCT
  • R:TGCTGGTCTTGCCATTCCT
179 58 SYBR
PGK1[3] Phosphoglycerate kinase-1

lung cancer cell lines

NM_000291
  • F:GCCACTTGCTGTGCCAAATG
  • R:CCCAGGAAGGACTTTACCTT
102 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:GUIZHEN ZHANG
  • Email:zhanguizhenjlu@163.com
  • Institution:Department of Central Laboratory, Second Hospital, Jilin University, 9 Ziqiang Street, Changchun, Jilin 130041, P.R. China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-01])

Mesenchymal Stromal Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TBP[4] TATA-binding protein
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells
NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
NA 60 SYBR
YWHAZ[4] tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • Human mesenchymal stromal cells from the bone marrow;
  • adipose-derived stromal cells
NM_001135702
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Mandana Haack
  • Email:Mandana.Haack-Soerensen@regionh.dk
  • Institution:Cardiology Stem Cell Centre, The Heart Centre, Rigshospitalet, Copenhagen University Hospital, Juliane Maries Vej 20, dept. 9302, 2100 Copenhagen, Denmark

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])

Glioma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[5] Glyceraldehyde-3-phosphate dehydrogenase
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_002046
  • F:TCGCCAGCCGAGCCACATC
  • R:CGTTCTCAGCCTTGACGGTGC
222 55 SYBR
RPL13A[5] Ribosomal protein L13a
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R: TTGAGGACCTCTGTGTATTTGTCAA
126 55 SYBR
CYC1[5] Cytochrome c-1
  • glioma compared with normal brain and anaplastic astrocytoma or glioblastoma
NM_001916
  • F:GAGGTGGAGGTTCAAGACGG
  • R:TAGCTCGCACGATGTAGCTG
160 55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Susanne Grube
  • Email:susanne.grube@med.uni-jena.de
  • Institution:Department of Neurosurgery, Section of Experimental Neurooncology, Jena University Hospital, Friedrich-Schiller-University Jena, Erlanger Allee 101, 07747 Jena, Germany

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-01])

Metastatic Clear Cell Renal Cell Carcinoma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL13[6] Ribosomal protein L13
  • 35 primary tumor nonmetastatic versus 35 mccRCC samples and matched metastasized T/C/M samples
NM_000977
  • F:TTCCGCTCGGCTGTTTTCCTG
  • R:GGGCCTTACGTCTGCGGATCTTA
164 59 Sybr
GUSB[6] Glucuronidase, beta
  • total 152 samples and in paired Tand C(n=140) kidney samples
NM_000181
  • F:ATGCAGGTGATGGAAGAAGTGGTG
  • R:AGAGTTGCTCACAAAGGTCACAGG
177 59 Sybr
RPLP0[6] Ribosomal protein, large, P0
  • matchedtumor-control-metastasized ccRCC samples
NM_001002
  • F:TAAACCCTGCGTGGCAATCCCTG
  • R:TGAACACAAAGCCCACATTCCCC
307 58.5 Sybr

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Zbigniew Kmiec
  • Email: pwierzb@gumed.edu.pl
  • Institution:Department of Histology, Faculty of Medicine, Medical University of Gdansk, ul. D?binki 1, PL 80-211 Gda��sk, Poland

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-06-01])

Differentiating Human Embryonic Stem Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[7] beta-2-microglobulin

differentiating human embryonic stem cells

NM_004048
  • F:TGCTGTCTCCATGTTTGATGTATCT
  • R:TCTCTGCTCCCCACCTCTAAGT
86 60 SYBR
RPL13A[7] ribosomal protein L13A

differentiating human embryonic stem cells

NM_012423
  • F:CCTGGAGGAGAAGAGGAAAGAGA
  • R:TTGAGGACCTCTGTGTATTTGTCAA
126 60 SYBR
AluSq [7] Alu repeats, subfamily Sq

differentiating human embryonic stem cells

NA
  • F:CATGGTGAAACCCCGTCTCTA
  • R:GCCTCAGCCTCCCGAGTAG
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Dieter Deforce
  • Email:Dieter.Deforce@UGent.be
  • Institution:Laboratory for Pharmaceutical Biotechnology, Ghent University, Harelbekestraat 72, Ghent 9000, Belgium

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])

Umbilical Vein Endothelial Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[8] Beta-2-microglobulin

human umbilical vein endothelial cells on substrates with different stiffness

NM_004048
  • F:CACCCCCACTGAAAAAGATGAG
  • R:CCTCCATGATGCTGCTTACATG
106 59 SYBR
HPRT-1[8] Hypoxanthine phosphoribosyl-transferase 1

human umbilical vein endothelial cells on substrates with different stiffness

NM_000194
  • F:GACCAGTCAACAGGGGACAT
  • R:AACACTTCGTGGGGTCCTTTTC
195 59 SYBR
YWHAZ[8] Tyrosine 3-monooxygenase/tryptophan 5–monooxygenase activation protein, zeta polypeptide

human umbilical vein endothelial cells on substrates with different stiffness

NM_003406
  • F:ACTTTTGGTACATTGTGGCTTCAA
  • R:CCGCCAGGACAAACCAGTAT
94 59 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Hong Zhou
  • Email:zhouhtt1966@163.com
  • Institution:Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing, China, 2National Center for Nanoscience and Technology, Beijing, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-16])

During THP-1 Monocyte Differentiation Into Macrophages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[9] b-actin

PMA-induced THP-1 monocyte-to-macrophage differentiation

NM_001101
  • F:ATTGCCGACAGGATGCAGAA
  • R:GCTGATCCACATCTGCTGGAA
150 60 SYBR
RPL37A[9] ribosomal protein L37a

PMA-induced THP-2 monocyte-to-macrophage differentiation

NM_000998.4
  • F:ATTGAAATCAGCCAGCACGC
  • R:AGGAACCACAGTGCCAGATCC
94 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Stefan Lorkowski
  • Email:stefan.lorkowski@uni-jena.de
  • Institution:Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Str. 25, 07743 Jena, Germany

Citation Statistics

Cited by 46 (Based on Google Scholar [2017-06-16])

Serous Ovarian Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GUSB[10] Beta-glucuronidase

serous ovarian cancer

NM_000181
  • F:AGCCAGTTCCTCATCAATGG
  • R:GGTAGTGGCTGGTACGGAAA
160 60 or 63 SYBR
PPIA[10] Peptidylprolyl isomerase A

serous ovarian cancer

NM_021130
  • F:AGACAAGGTCCCAAAGAC
  • R:ACCACCCTGACACATAAA
118 61 or 63 SYBR
TBP[10] TATA box binding protein

serous ovarian cancer

NM_003194
  • F:TGCACAGGAGCCAAGAGTGAA
  • R:CACATCACAGCTCCCCACCA
132 62 or 63 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Xing Xie
  • Email:xiex@mail.hz.zj.cn
  • Institution:Reproductive Health Laboratory of Zhejiang Province, Department of Gynecologic Oncology, Women Hospital, School of Medicine, Zhejiang University, Xueshi Rd. No. 2, *Institution:Hangzhou 310006, China

Citation Statistics

Cited by 78 (Based on Google Scholar [2017-06-16])

Normal Thyroid and Goiter Tissue

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[11] Beta-actin

normal thyroid and goiter tissues

NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAATGCA
140 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Tania Weber Furlanetto
  • Email:taniafurlanetto@gmail.com
  • Institute:UniversidadeFederaldoRioGrandedoSul,RuaRamiroBarcelos2400, 90035-903 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-16])

Colonic and Vaginal Epithelial Cell Lines

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PGK1[12] phosphoglycerate kinase 1

HT-29 cells

NM_000291
  • F:GAGATGATTATTGGTGGTGGAA
  • R:AGTCAACAGGCAAGGTAATC
NA 60 SYBR
RPLP0[12] ribosomal protein large P0

VK2/E6E7 cells

NM_001002
  • F:ACAATGGCAGCATCTACA
  • R:GTAATCCGTCTCCACAGA
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Nikolai Scherbak
  • Email:nikolai.scherbak@oru.se
  • Institution:School of Science and Technology, Sweden

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-16])

Myocardium

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SRP14[13] Signal recognition particle 14 kDa

myocardium

NM_003134
  • F:CAGATGGCTTATTCAAACCTCCT
  • R:ATGCCCTTTACTGTGCTGCT
181 60~61 SYBR
TPT1[13] translationally-controlled 1

myocardium

NM_003295
  • F:AAATGTTAACAAATGTGGCAATTAT
  • R:AACAATGCCTCCACTCCAAA
164 58~61 SYBR
EEF1A1[13] eukaryotic elongation factor 1A1

myocardium

NM_015905
  • F:CTTTGGGTCGCTTTGCTGTT
  • R:CCGTTCTTCCACCACTGATT
183 60~63 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Vicky A Cameron
  • Email:vicky.cameron@otago.ac.nz
  • Institution: Christchurch Cardioendocrine Research Group, Department of Medicine, University of Otago-Christchurch, PO Box 4345, Christchurch 8014, New Zealand

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-06-16])

Breast Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[14] Beta actin

breast cancer samples

NM_001101
  • F:CTGGAACGGTGAAGGTGACA
  • R:AAGGGACTTCCTGTAACAACGCA
140 64 SYBR
RPS23[14] 40S ribosomal protein S23

breast cancer samples

NM_001025
  • F:CGGTGCTTCTCTCTTTCGCT
  • R:ATGCCACTTCTGGTCTCGT
110 64 SYBR
HUWE1[14] E3 ubiquitin-protein ligase HUWE1

breast cancer samples

NM_031407
  • F:CAGAGTTGGACAGAGTGAAA
  • R:TACACAGAGAGAGGAGGACA
137 64 SYBR
EEF1A1[14] Elongation factor 1-alpha 1

breast cancer samples

NM_001402
  • F:TGAAAACTACCCCTAAAAGCCA
  • R: TATCCAAGACCCAGGCATACT
208 64 SYBR
SF3A1[14] Splicing factor 3 subunit 1

breast cancer samples

NM_005877
  • F:AAGGGTCCAGTGTCCATCAAAGT
  • R:GCCATGTTGTAGTAAGCCAGTGAG
224 64 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Alexander G Tonevitsky
  • Email:d.maltseva@bioclinicum.com
  • Institution:SRC Bioclinicum, Moscow, Russia

Citation Statistics

Cited by 36 (Based on Google Scholar [2017-06-16])

Prostate Cancer Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[15] glyceraldehyde-3-phosphate dehydrogenase

prostate cancer cells

NM_002046
  • F:CTTTGTCAAGCTCATTTCCTGG
  • R:TCTTCCTCTTGTGCTCTTGC
133 NA SYBR
SDHA[15] succinate dehydrogenase complex, subunit A, flavoprotein(Fp)

prostate cancer cells

NM_004168
  • F:TGGTTGTCTTTGGTCGGG
  • R:GCGTTTGGTTTAATTGGAGGG
85 NA SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Gisele Branchini
  • Email:giseleb@ufcspa.edu.br
  • Institution: Universidade Federal do Rio Grande do Sul, Rua Sarmento Leite 500, 28 andar, Porto Alegre, RS 90050-170, Brazil

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-06-16])

Stomach Cancer

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
B2M[16] Beta-2-microglobulin

stomach cancer cell lines;all stomach tissues

NM_004048
  • F:ACTGAATTCACCCCCACTGA
  • R:CCTCCATGATGCTGCTTACA
114 58 SYBR
GAPDH[16] Ribosomal protein L29

stomach cancer cell lines

NM_002046
  • F:TGCACCACCAACTGCTTA
  • R:GGATGCAGGGATGATGTTC
177 58 SYBR
RPL29[16] Ribosomal protein L29

all stomach tissues

NM_000992
  • F:GGCGTTGTTGACCCTATTTC
  • R:GTGTGTGGTGTGGTTCTTGG
120 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Sung-Ho Goh
  • Email:andrea@ncc.re.kr
  • Institution:Research institute, National Cancer Center, 809 Madu-dong, Goyang, Gyeonggi-do 410-769, Republic of Korea

Citation Statistics

Cited by 55 (Based on Google Scholar [2017-06-16])

Endometrioid Endometrial Carcinoma Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PPIA[17] Peptidylprolyl isomerase A (Cyclophilin A)
  • endometrial tumor samples at different tumor degrees
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
NM_021130
  • F: gaggaaaaccgtgtactattagc
  • R:gggaccttgtctgcaaac
113 60 SYBR
HPRT1[17] Hypoxanthine phosphoribosyltransferase 1
  • study groups regardless of sample type
  • endometrioid endometrial cancer samples
NM_000194
  • F:ctggaaagaatgtcttgattgtg
  • R: gaccttgaccatctttggatta
104 60 SYBR
GAPDH[17] Glyceraldehyde-3-phosphate dehydrogenase
  • endometrioid endometrial cancer samples
NM_002046
  • F:cccttcattgacctcaactacatg
  • R: tgggatttccattgatgacaagc
115 60 SYBR
H3F3A[17] H3 histone, family 3A
  • endometrioid endometrial cancer samples
NM_002107
  • F: tgctcaggactttaaaacaga
  • R: cacaggttggtgtcttcaa
108 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Eliana Bignotti
  • Email:cromani76@gmail.com
  • Institution:Angelo Nocivelli Institute of Molecular Medicine, Division of Gynecologic Oncology, University of Brescia, Brescia, Italy,

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-16])

Epicardial Adipose Tissue

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CYCA[18] Peptidylprolyl isomerase A

human epicardial adipose tissue

NM_021130
  • F:ATCCTAGAGGTGGCGGATTT
  • R:CACTCAGGTCTGAGCCACAA
NA NA SYBR
GAPDH[18] Glycerladehyde 3-phosphate dehydrogenase

human epicardial adipose tissue

NM_002046
  • F:ATGTTCGTCATGGGTGTGAA
  • R:GGTGCTAAGCAGTTGGTGGT
NA NA SYBR
RPL27[18] Ribosomal protein L27

human epicardial adipose tissue

NM_000988
  • F: GTGAAAGTGTATAACTACAATCACC
  • R: TCAAACTTGACCTTGGCCT
NA NA SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Denis Richard
  • Email:Denis.Richard@criucpq.ulaval.ca
  • Institution:Centre de Recherche de Universitaire de Cardiologie et de Pneumologie, Canada

Citation Statistics

Cited by 28 (Based on Google Scholar [2017-06-16])

Umbilical Vein Endothelial Cells on Substrates with Different Stiffness

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SDHA[19] Succinate dehydrogenase complex, subunit A

Cartilage Endplate of the Lumbar Spine

NM_004168
  • F:agacctaaagcacctgaagacg
  • R:atcaatccgcaccttgtagtct
175 60 SYBR
B2M[19] Beta-2-microglobulin

Cartilage Endplate of the Lumbar Spine

NM_004048
  • F:atccatccgacattgaagttg
  • R:ggcaggcatactcatctttttc
150 60 SYBR
LDHA[19] Lactate dehydrogenase A

Cartilage Endplate of the Lumbar Spine

NM_005566
  • F:gcctgtatggagtggaatgaa
  • R:ccaggatgtgtagcctttgag
157 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Shun-Wu Fan
  • Email:zzj-0708@163.com
  • Institution:Department of Orthopaedic Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou Zhejiang, China

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-06-16])

Head and Neck Squamous Cell Carcinoma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[20] glyceraldehyde-3-phosphate dehydrogenase
  • head and neck squamous cell carcinoma
NM_002046
  • F:tgaacgggaagctcactgg
  • R:tccaccaccctgttgctgta
307 60 SYBR
SDHA[20] succinate dehydrogenase complex, subunit A, flavoprotein
  • head and neck squamous cell carcinoma
NM_004168
  • F:agcaagctctatggagacct
  • R:taatcgtactcatcaatccg
200 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Jean-Paul Brouillet
  • Email:jpbrouillet@gmail.com
  • Institution:Centre National de la Recherche Scientifique, Montpellier F-34094, France

Citation Statistics

Cited by 36 (Based on Google Scholar [2017-06-16])

Cartilage Endplate of the Lumbar Spine

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PPIA[21] peptidylprolyl isomerase A (cyclophilin A)

ccRCC tissues

NM_021130
  • F:ACCGCCGAGGAAAACCGTGTA
  • R:TGCTGTCTTTGGGACCTTGTCTGC
129 60 SYBR
RPS13[21] ribosomal protein S13

ccRCC tissues

NM_001017
  • F:TCGGCTTTACCCTATCGACGCAG
  • R:ACGTACTTGTGCAACACCATGTGA
153 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name:Christophe E Pierreux
  • Email:christophe.pierreux@uclouvain.be
  • Institution:CELL Unit, de Duve Institute, Avenue Hippocrate 75, 1200 Brussels, Belgium

Citation Statistics

Cited by 19 (Based on Google Scholar [2017-06-16])

Osteoarthritic Articular Cartilage

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer PCR Size (bp) Tm Detection
TBP[22] TATA-box binding protein
  • articular cartilage
NM_003194
  • F: 5-tgcacaggagccaagagtgaa-3
  • R: 5-cacatcacagctccccacca-3
132 56 ℃  SYBR
RPL13A[22] polymerase II large subunit
  • articular cartilage
NM_012423
  • F: 5-aaaaagcggatggtggttc-3
  • R: 5-cttccggtagtggatcttgg-3
168 56 ℃  SYBR
B2M[22] polymerase II large subunit
  • articular cartilage
NM_004048
  • F: 5-atgagtatgcctgccgtgtga-3
  • R: 5-ggcatcttcaaacctccatg-3
101 56 ℃  SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Antonio Gonzalez
  • Email: Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
  • Institution: Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain

Citation Statistics

Cited by 74 (Based on Google Scholar [2017-06-16])

Hepatocellular Carcinoma

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
HMBS[23] hydroxymethylbilane synthase
  • Universial reference gene for gene expression studies in HCC
NM_000190.3
  • F: 5-TGCAACGGCGGAAGAAAA-3
  • R: 5-ACGAGGCTTTCAATGTTGCC-3
113 56.4 SYBR
GAPDH[23] Glyceraldehyde-3-phosphate dehydrogenase
  • between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC
  • among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
NM_012423
  • F: 5-TGCACCACCAACTGCTTAGC-3
  • R: 5-GGCATGGACTGTGGTCATGAG-3
87 56.4 SYBR
UBC[23] ubiquitin C
  • for tumor tissues
NM_021009.3
  • F: 5-CGGTGAACGCCGATGATTAT-3
  • R: 5-ATCTGCATTGTCAAGTGACGA-3
124 56.4 SYBR
SDHA[23] succinate dehydrogenase complex, subunit A
  • for five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
NM_004168.2
  • F: 5-TGGGAACAAGAGGGC ATCTG-3
  • R: 5-CCACCACTGCATCAAATTCATG-3
86 56.4 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Susanne Beckebaum
  • Email: Antonio.Gonzalez.Martinez-Pedrayo@sergas.es
  • Institution: susanne.beckebaum@uni-due.de

Citation Statistics

Cited by 91 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Mehta R, Birerdinc A, Hossain N, et al. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples[J]. BMC Molecular Biology, 2010, 11(1): 39.
  2. 2.0 2.1 2.2 Vázquez-Blomquist D, Fernández J R, Miranda J, et al. Selection of reference genes for use in quantitative reverse transcription PCR assays when using interferons in U87MG[J]. Molecular biology reports, 2012, 39(12): 11167-11175.
  3. 3.0 3.1 3.2 Ali H, Du Z, Li X, et al. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro[J]. Molecular medicine reports, 2015, 11(5): 3767-3773.
  4. 4.0 4.1 Tratwal J, Follin B, Ekblond A, Kastrup J, Haack-Sørensen M. Identification of a common reference gene pair for qPCR in human mesenchymal stromal cells from different tissue sources treated with VEGF. BMC Mol Biol. 2014 May 28;15:11. doi: 10.1186/1471-2199-15-11. PubMed PMID: 24885696; PubMed Central PMCID: PMC4045907.
  5. 5.0 5.1 5.2 Grube S, Göttig T, Freitag D, Ewald C, Kalff R, Walter J. Selection of suitable reference genes for expression analysis in human glioma using RT-qPCR. J Neurooncol. 2015 May;123(1):35-42. doi: 10.1007/s11060-015-1772-7. Epub 2015 Apr 11. PubMed PMID: 25862007.
  6. 6.0 6.1 6.2 Wierzbicki P M, Klacz J, Rybarczyk A, et al. Identification of a suitable qPCR reference gene in metastatic clear cell renal cell carcinoma[J]. Tumor Biology, 2014, 35(12): 12473-12487.
  7. 7.0 7.1 7.2 Vossaert L, O’Leary T, Van Neste C, et al. Reference loci for RT-qPCR analysis of differentiating human embryonic stem cells[J]. BMC molecular biology, 2013, 14(1): 21.
  8. 8.0 8.1 8.2 Chen G, Zhao L, Feng J, et al. Validation of reliable reference genes for real-time PCR in human umbilical vein endothelial cells on substrates with different stiffness[J]. PLoS One, 2013, 8(6): e67360.
  9. 9.0 9.1 Maeß M B, Sendelbach S, Lorkowski S. Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages[J]. BMC molecular biology, 2010, 11(1): 90.
  10. 10.0 10.1 10.2 Li Y L, Ye F, Hu Y, et al. Identification of suitable reference genes for gene expression studies of human serous ovarian cancer by real-time polymerase chain reaction[J]. Analytical biochemistry, 2009, 394(1): 110-116.
  11. Weber R, Bertoni A P S, Bessestil L W, et al. Validation of reference genes for normalization gene expression in reverse transcription quantitative PCR in human normal thyroid and goiter tissue[J]. BioMed research international, 2014, 2014.
  12. 12.0 12.1 Jacobsen A V, Yemaneab B T, Jass J, et al. Reference gene selection for qPCR Is dependent on cell type rather than treatment in colonic and vaginal human epithelial cell lines[J]. PloS one, 2014, 9(12): e115592.
  13. 13.0 13.1 13.2 Pilbrow A P, Ellmers L J, Black M A, et al. Genomic selection of reference genes for real-time PCR in human myocardium[J]. BMC medical genomics, 2008, 1(1): 64.
  14. 14.0 14.1 14.2 14.3 14.4 Maltseva D V, Khaustova N A, Fedotov N N, et al. High-throughput identification of reference genes for research and clinical RT-qPCR analysis of breast cancer samples[J]. Journal of clinical bioinformatics, 2013, 3(1): 13.
  15. 15.0 15.1 Souza A F D, Brum I S, Neto B S, et al. Reference gene for primary culture of prostate cancer cells[J]. Molecular biology reports, 2013, 40(4): 2955-2962.
  16. 16.0 16.1 16.2 Rho H W, Lee B C, Choi E S, et al. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR[J]. BMC cancer, 2010, 10(1): 240.
  17. 17.0 17.1 17.2 17.3 Romani C, Calza S, Todeschini P, et al. Identification of optimal reference genes for gene expression normalization in a wide cohort of endometrioid endometrial carcinoma tissues[J]. PloS one, 2014, 9(12): e113781.
  18. 18.0 18.1 18.2 Chechi K, Gelinas Y, Mathieu P, et al. Validation of reference genes for the relative quantification of gene expression in human epicardial adipose tissue[J]. PloS one, 2012, 7(4): e32265.
  19. 19.0 19.1 19.2 Zhou Z J, Zhang J F, Xia P, et al. Selection of suitable reference genes for normalization of quantitative real-time polymerase chain reaction in human cartilage endplate of the lumbar spine[J]. PLoS One, 2014, 9(2): e88892.
  20. 20.0 20.1 Lallemant B, Evrard A, Combescure C, et al. Reference gene selection for head and neck squamous cell carcinoma gene expression studies[J]. BMC Molecular Biology, 2009, 10(1): 78.
  21. 21.0 21.1 Dupasquier S, Delmarcelle A S, Marbaix E, et al. Validation of housekeeping gene and impact on normalized gene expression in clear cell renal cell carcinoma: critical reassessment of YBX3/ZONAB/CSDA expression[J]. BMC molecular biology, 2014, 15(1): 9.
  22. 22.0 22.1 22.2 Pombo-Suarez M, Calaza M, Gomez-Reino J J, et al. Reference genes for normalization of gene expression studies in human osteoarthritic articular cartilage[J]. BMC molecular biology, 2008, 9(1): 17.
  23. 23.0 23.1 23.2 23.3 Cicinnati V R, Shen Q, Sotiropoulos G C, et al. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR[J]. BMC cancer, 2008, 8(1): 350.