Difference between revisions of "Hordeum vulgare"

From ICG
Jump to navigation Jump to search
Line 164: Line 164:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
+
[[Category:Plants]] [[Category:miRNA]] [[Category:mRNA]]

Revision as of 15:32, 17 June 2017

Description

REFqPCR2015021-1.jpg
  • Barley (Hordeum vulgare) is one of the most important cereal crops cultivated in the world and, with a large amount of genetic and genomic data available, including its full genome sequence, is a model for cereal genomics studies.
  • The average yield of Australian barley is 2 t/ha [1], which is below the world average of 3 t/ha. Barley production in southern Australia is particularly constrained by cyclic and terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses.
  • Yield is a complex quantitative trait whose expression is highly influenced by the environment and agronomic management. This makes phenotype-based selection slow and unreliable, especially under environments where multiple abiotic stresses prevail. Developing barley varieties with improved and stable yield in such environments is expected to be more challenging with ongoing climate change, thus requiring substantial changes in agronomic practices and crop improvement approaches. [1] [2].

Various Stress Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Hvu-ADP[1] ADP-ribosylation factor 1-like protein
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:GCTCTCCAACAACATTGCCAAC
  • R:GCTCTCCAACAACATTGCCAAC
77 60 SYBR
Hvu-snoR14[1] Hvu-snoR14
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:GATGTTTATGTATGATAGTCTGTC
  • R:GATGTTTATGTATGATAGTCTGTC
67 60 SYBR
Hvu-snoR23[1] Hvu-snoR23
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:TCGGCAGTGGTGTCATC
  • R:TCGGCAGTGGTGTCATC
64 60 SYBR

Moleculer Types

  • mRNA & miRNA

Evaluation Methods

Contact

  • Name: S.K. Bhure
  • Email: sdbhure@rediffmail.com
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-06-16])

Different Developmental stages & Leaf Age

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ADP[2] ADP-ribozylation factor 1
  • drought-induced changes at the seedling stage
  • comparison between these two stages
NA
  • F:CGTGACGCTGTGTTGCTTGT
  • R: CCGCATTCATCGCATTAGG
61 60 SYBR
UBI[2] ubiquitin
  • drought-induced changes at the seedling stage
NA
  • F:TCGCCGTCCTCCAGTTCTAC
  • R:CCTTCCTGAGCCTGGTTACCT
63 59 SYBR
ACT[2] Actin
  • during heading
NA
  • F:CGACAATGGAACCGGAATG
  • R: CCCTTGGCGCATCATCTC
56 58 SYBR
GAPDH[2] glyceraldehyde-3-phosphate dehydrogenase
  • during heading
NA
  • F:TTCGGCGAGAAGCCAGTTA
  • R:CCTCACCCCACGGGATCT
64 58 SYBR
HSP90[2] Heat shock protein 90
  • comparison between these two stages
NA
  • F: AAGATGGAGGAGGTCGACTAAGC
  • R:GCAGGGCATGGACATACGA
59 59 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Marcin Rapacz
  • Email: rrrapacz@cyf-kr.edu.pl
  • Institute: Department of Plant Physiology, University of Agriculture in Krakow, Podłu_ zna 3, 30-239 Krako´w, Poland

References

  1. 1.0 1.1 1.2 1.3 Ferdous J, Li Y, Reid N, et al. (2015) Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions. PLoS One 10, e0118503
  2. 2.0 2.1 2.2 2.3 2.4 2.5 Rapacz M, Stępień A, Skorupa K. Internal standards for quantitative RT-PCR studies of gene expression under drought treatment in barley (Hordeum vulgare L.): the effects of developmental stage and leaf age[J]. Acta physiologiae plantarum, 2012, 34(5): 1723-1733.