Difference between revisions of "Hordeum vulgare"

From ICG
Jump to navigation Jump to search
 
(39 intermediate revisions by 8 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015021-1.jpg|right|272px|]]
+
[[File:Hordeum vulgare.png|right|200px|link=Hordeum vulgare]]
* Barley (Hordeum vulgare) is one of the most important cereal crops cultivated in the world and, with a large amount of genetic and genomic data available, including its full genome sequence, is a model for cereal genomics studies.  
+
*'''''Hordeum vulgare''''' is one of the most important cereal crops cultivated in the world. Its production in southern Australia is particularly constrained by cyclic and plant terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses. As a model plant with a large amount of genetic and genomic data available, it is still challenging to develop varieties with improved and stable yield in strssed environments with ongoing climate change. Substantial changes are needed for crop improvement approaches<ref name="ref1"/> <ref name="ref2"/>.
* The average yield of Australian barley is 2 t/ha [1], which is below the world average of 3 t/ha. Barley production in southern Australia is particularly constrained by cyclic and terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses.  
+
* <font color=blue>'''Common Name:'''</font> '''Barley'''
* Yield is a complex quantitative trait whose expression is highly influenced by the environment and agronomic management. This makes phenotype-based selection slow and unreliable, especially under environments where multiple abiotic stresses prevail. Developing barley varieties with improved and stable yield in such environments is expected to be more challenging with ongoing climate change, thus requiring substantial changes in agronomic practices and crop improvement approaches. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4513 <font color=blue>'''NCBI Taxonomy'''</font>]
=='''''Various Stress Conditions'''''==
+
 
===Reference Genes===
+
=='''''Abiotic & Biotic Stress'''''==
 +
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 12: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 21: Line 22:
 
|
 
|
 
* Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
 
* Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
|align="center"| NA
+
|align="center"| [http://www.ncbi.nlm.nih.gov/nuccore/AJ508228.2 '''AJ508228.2''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCTCTCCAACAACATTGCCAAC
 
* F:GCTCTCCAACAACATTGCCAAC
* R:GCTCTCCAACAACATTGCCAAC
+
* R:GAGACATCCAGCATCATTCATTCC
 
|align="center"|  77  
 
|align="center"|  77  
 
|align="center"| 60
 
|align="center"| 60
Line 36: Line 37:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GATGTTTATGTATGATAGTCTGTC
 
* F:GATGTTTATGTATGATAGTCTGTC
* R:GATGTTTATGTATGATAGTCTGTC
+
* R:GTCGGGATGTATGCGTGTC
 
|align="center"|  67  
 
|align="center"|  67  
 
|align="center"| 60
 
|align="center"| 60
Line 48: Line 49:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCGGCAGTGGTGTCATC
 
* F:TCGGCAGTGGTGTCATC
* R:TCGGCAGTGGTGTCATC
+
* R:CTCAGTGGAAAGAGAAGTCG
 
|align="center"|  64  
 
|align="center"|  64  
 
|align="center"| 60
 
|align="center"| 60
Line 54: Line 55:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA & miRNA
 
* mRNA & miRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 68: Line 70:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''16''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16867362328814749337&as_sdt=2005&sciodt=0,5&hl=en'''16'''] (Based on Google Scholar [2017-09-01])
 +
 
 +
=='''''Different Developmental stages'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25% font-size:9pt "|Application Scope
 +
! Accession Number
 +
! Primer
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| ADP<ref name="ref2"/>
 +
|align="center"| ADP-ribozylation factor 1
 +
|
 +
* Drought-induced changes at the seedling stage
 +
* Comparison between seedling and heading stage
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ508228.2 '''AJ508228.2''']
 +
|nowrap style="font-size:9pt"|
 +
* F:CGTGACGCTGTGTTGCTTGT
 +
* R: CCGCATTCATCGCATTAGG
 +
|align="center"| 61
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| UBI<ref name="ref2"/>
 +
|align="center"| Ubiquitin
 +
|
 +
* Drought-induced changes at the seedling stage
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/M60175.1 '''M60175.1''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TCGCCGTCCTCCAGTTCTAC
 +
* R:CCTTCCTGAGCCTGGTTACCT
 +
|align="center"| 63
 +
|align="center"| 59
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| ACT<ref name="ref2"/>
 +
|align="center"| Actin
 +
|
 +
* During heading
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY145451 '''AY145451''']
 +
|nowrap style="font-size:9pt"|
 +
* F:CGACAATGGAACCGGAATG
 +
* R: CCCTTGGCGCATCATCTC
 +
|align="center"| 56
 +
|align="center"| 58
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| GADPH<ref name="ref2"/>
 +
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 +
|
 +
* During heading
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/X60343.1 '''X60343.1''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TTCGGCGAGAAGCCAGTTA
 +
* R:CCTCACCCCACGGGATCT
 +
|align="center"| 64
 +
|align="center"| 58
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| HSP90<ref name="ref2"/>
 +
|align="center"| Heat shock protein 90
 +
|
 +
* Comparison between seedling and heading stage
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY325266.1 '''AY325266.1''']
 +
|nowrap style="font-size:9pt"|
 +
* F: AAGATGGAGGAGGTCGACTAAGC
 +
* R:GCAGGGCATGGACATACGA
 +
|align="center"| 59
 +
|align="center"| 59
 +
|align="center"| SYBR
 +
|}
 +
 
 +
===Molecular Types===
 +
*mRNA
 +
 
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Marcin Rapacz
 +
*'''Email''':  rrrapacz@cyf-kr.edu.pl
 +
*'''Institution''': Department of Plant Physiology, University of Agriculture in Krakow, Podłu_ zna 3, 30-239 Krako´w, Poland
 +
 
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=17492077440170478518&as_sdt=2005&sciodt=0,5&hl=en'''23'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 76: Line 167:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
namObsa BT, Eglinton J, Coventry S, et al. (2017) Quantitative trait loci for yield and grain plumpness relative to maturity in three populations of barley (Hordeum vulgare L.) grown in a low rain-fall environment. PLoS One 12, e01781
+
Rapacz M, Stępień A, Skorupa K. Internal standards for quantitative RT-PCR studies of gene expression under drought treatment in barley (Hordeum vulgare L.): the effects of developmental stage and leaf age[J]. Acta physiologiae plantarum, 2012, 34(5): 1723-1733.
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
+
=='''Categories'''==
 +
[[Category:Plants]][[Category:non-coding RNA]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]] [[Category:ADP]] [[Category:ARF]] [[Category:GAPDH]] [[Category:HSP90]][[Category:Small RNAs]][[Category:Ubiquitin]][[Category:Salinity Treatment]][[Category:Abiotic Stress]] [[Category:Different Developmental Stages]]  [[Category:Fungal infection]][[Category:Biotic Stress]][[Category:Drought Treatment]][[Category:geNorm]] [[Category:NormFinder]] [[Category:BestKeeper]] [[Category:Delta Ct]] [[Category:RefFinder]]

Latest revision as of 06:52, 1 September 2017

Description

Hordeum vulgare.png
  • Hordeum vulgare is one of the most important cereal crops cultivated in the world. Its production in southern Australia is particularly constrained by cyclic and plant terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses. As a model plant with a large amount of genetic and genomic data available, it is still challenging to develop varieties with improved and stable yield in strssed environments with ongoing climate change. Substantial changes are needed for crop improvement approaches[1] [2].
  • Common Name: Barley
  • NCBI Taxonomy

Abiotic & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Hvu-ADP[1] ADP-ribosylation factor 1-like protein
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
AJ508228.2
  • F:GCTCTCCAACAACATTGCCAAC
  • R:GAGACATCCAGCATCATTCATTCC
77 60 SYBR
Hvu-snoR14[1] Hvu-snoR14
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:GATGTTTATGTATGATAGTCTGTC
  • R:GTCGGGATGTATGCGTGTC
67 60 SYBR
Hvu-snoR23[1] Hvu-snoR23
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:TCGGCAGTGGTGTCATC
  • R:CTCAGTGGAAAGAGAAGTCG
64 60 SYBR

Molecular Types

  • mRNA & miRNA

Evaluation Methods

Contact

  • Name: S.K. Bhure
  • Email: sdbhure@rediffmail.com
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-09-01])

Different Developmental stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ADP[2] ADP-ribozylation factor 1
  • Drought-induced changes at the seedling stage
  • Comparison between seedling and heading stage
AJ508228.2
  • F:CGTGACGCTGTGTTGCTTGT
  • R: CCGCATTCATCGCATTAGG
61 60 SYBR
UBI[2] Ubiquitin
  • Drought-induced changes at the seedling stage
M60175.1
  • F:TCGCCGTCCTCCAGTTCTAC
  • R:CCTTCCTGAGCCTGGTTACCT
63 59 SYBR
ACT[2] Actin
  • During heading
AY145451
  • F:CGACAATGGAACCGGAATG
  • R: CCCTTGGCGCATCATCTC
56 58 SYBR
GADPH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • During heading
X60343.1
  • F:TTCGGCGAGAAGCCAGTTA
  • R:CCTCACCCCACGGGATCT
64 58 SYBR
HSP90[2] Heat shock protein 90
  • Comparison between seedling and heading stage
AY325266.1
  • F: AAGATGGAGGAGGTCGACTAAGC
  • R:GCAGGGCATGGACATACGA
59 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Marcin Rapacz
  • Email: rrrapacz@cyf-kr.edu.pl
  • Institution: Department of Plant Physiology, University of Agriculture in Krakow, Podłu_ zna 3, 30-239 Krako´w, Poland

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Ferdous J, Li Y, Reid N, et al. (2015) Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions. PLoS One 10, e0118503
  2. 2.0 2.1 2.2 2.3 2.4 2.5 Rapacz M, Stępień A, Skorupa K. Internal standards for quantitative RT-PCR studies of gene expression under drought treatment in barley (Hordeum vulgare L.): the effects of developmental stage and leaf age[J]. Acta physiologiae plantarum, 2012, 34(5): 1723-1733.

Categories