Difference between revisions of "Hordeum vulgare"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
(20 intermediate revisions by 7 users not shown) | |||
Line 1: | Line 1: | ||
==Description== | ==Description== | ||
− | [[File: | + | [[File:Hordeum vulgare.png|right|200px|link=Hordeum vulgare]] |
− | * | + | *'''''Hordeum vulgare''''' is one of the most important cereal crops cultivated in the world. Its production in southern Australia is particularly constrained by cyclic and plant terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses. As a model plant with a large amount of genetic and genomic data available, it is still challenging to develop varieties with improved and stable yield in strssed environments with ongoing climate change. Substantial changes are needed for crop improvement approaches<ref name="ref1"/> <ref name="ref2"/>. |
− | + | * <font color=blue>'''Common Name:'''</font> '''Barley''' | |
− | + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4513 <font color=blue>'''NCBI Taxonomy'''</font>] | |
=='''''Abiotic & Biotic Stress'''''== | =='''''Abiotic & Biotic Stress'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 22: | Line 22: | ||
| | | | ||
* Drought, fungal infection, boron toxicity, nutrient deficiency and salinity | * Drought, fungal infection, boron toxicity, nutrient deficiency and salinity | ||
− | |align="center"| | + | |align="center"| [http://www.ncbi.nlm.nih.gov/nuccore/AJ508228.2 '''AJ508228.2'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GCTCTCCAACAACATTGCCAAC | * F:GCTCTCCAACAACATTGCCAAC | ||
Line 70: | Line 70: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by '''16''' (Based on Google Scholar [2017- | + | Cited by [https://scholar.google.com/scholar?cites=16867362328814749337&as_sdt=2005&sciodt=0,5&hl=en'''16'''] (Based on Google Scholar [2017-09-01]) |
=='''''Different Developmental stages'''''== | =='''''Different Developmental stages'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 90: | Line 90: | ||
* Drought-induced changes at the seedling stage | * Drought-induced changes at the seedling stage | ||
* Comparison between seedling and heading stage | * Comparison between seedling and heading stage | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ508228.2 '''AJ508228.2'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CGTGACGCTGTGTTGCTTGT | * F:CGTGACGCTGTGTTGCTTGT | ||
Line 99: | Line 99: | ||
|- | |- | ||
|align="center"| UBI<ref name="ref2"/> | |align="center"| UBI<ref name="ref2"/> | ||
− | |align="center"| | + | |align="center"| Ubiquitin |
| | | | ||
* Drought-induced changes at the seedling stage | * Drought-induced changes at the seedling stage | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/M60175.1 '''M60175.1'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TCGCCGTCCTCCAGTTCTAC | * F:TCGCCGTCCTCCAGTTCTAC | ||
Line 114: | Line 114: | ||
| | | | ||
* During heading | * During heading | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY145451 '''AY145451'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CGACAATGGAACCGGAATG | * F:CGACAATGGAACCGGAATG | ||
Line 122: | Line 122: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|- | |- | ||
− | |align="center"| | + | |align="center"| GADPH<ref name="ref2"/> |
− | |align="center"| | + | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase |
| | | | ||
* During heading | * During heading | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/X60343.1 '''X60343.1'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TTCGGCGAGAAGCCAGTTA | * F:TTCGGCGAGAAGCCAGTTA | ||
Line 138: | Line 138: | ||
| | | | ||
* Comparison between seedling and heading stage | * Comparison between seedling and heading stage | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY325266.1 '''AY325266.1'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F: AAGATGGAGGAGGTCGACTAAGC | * F: AAGATGGAGGAGGTCGACTAAGC | ||
Line 147: | Line 147: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
− | * mRNA | + | *mRNA |
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 158: | Line 159: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by '''23''' (Based on Google Scholar [2017- | + | Cited by [https://scholar.google.com/scholar?cites=17492077440170478518&as_sdt=2005&sciodt=0,5&hl=en'''23'''] (Based on Google Scholar [2017-09-01]) |
=='''References'''== | =='''References'''== | ||
Line 169: | Line 170: | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | [[Category:Plants]] [[Category: | + | =='''Categories'''== |
− | [[Category:ACT]] [[Category:ADP]] [[Category: | + | [[Category:Plants]][[Category:non-coding RNA]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]] [[Category:ADP]] [[Category:ARF]] [[Category:GAPDH]] [[Category:HSP90]][[Category:Small RNAs]][[Category:Ubiquitin]][[Category:Salinity Treatment]][[Category:Abiotic Stress]] [[Category:Different Developmental Stages]] [[Category:Fungal infection]][[Category:Biotic Stress]][[Category:Drought Treatment]][[Category:geNorm]] [[Category:NormFinder]] [[Category:BestKeeper]] [[Category:Delta Ct]] [[Category:RefFinder]] |
− | [[Category:Salinity Treatment]] |
Latest revision as of 06:52, 1 September 2017
Contents
Description
- Hordeum vulgare is one of the most important cereal crops cultivated in the world. Its production in southern Australia is particularly constrained by cyclic and plant terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses. As a model plant with a large amount of genetic and genomic data available, it is still challenging to develop varieties with improved and stable yield in strssed environments with ongoing climate change. Substantial changes are needed for crop improvement approaches[1] [2].
- Common Name: Barley
- NCBI Taxonomy
Abiotic & Biotic Stress
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Hvu-ADP[1] | ADP-ribosylation factor 1-like protein |
|
AJ508228.2 |
|
77 | 60 | SYBR |
Hvu-snoR14[1] | Hvu-snoR14 |
|
NA |
|
67 | 60 | SYBR |
Hvu-snoR23[1] | Hvu-snoR23 |
|
NA |
|
64 | 60 | SYBR |
Molecular Types
- mRNA & miRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: S.K. Bhure
- Email: sdbhure@rediffmail.com
- Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India
Citation Statistics
Cited by 16 (Based on Google Scholar [2017-09-01])
Different Developmental stages
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ADP[2] | ADP-ribozylation factor 1 |
|
AJ508228.2 |
|
61 | 60 | SYBR |
UBI[2] | Ubiquitin |
|
M60175.1 |
|
63 | 59 | SYBR |
ACT[2] | Actin |
|
AY145451 |
|
56 | 58 | SYBR |
GADPH[2] | Glyceraldehyde-3-phosphate dehydrogenase |
|
X60343.1 |
|
64 | 58 | SYBR |
HSP90[2] | Heat shock protein 90 |
|
AY325266.1 |
|
59 | 59 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Marcin Rapacz
- Email: rrrapacz@cyf-kr.edu.pl
- Institution: Department of Plant Physiology, University of Agriculture in Krakow, Podłu_ zna 3, 30-239 Krako´w, Poland
Citation Statistics
Cited by 23 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 Ferdous J, Li Y, Reid N, et al. (2015) Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions. PLoS One 10, e0118503
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 Rapacz M, Stępień A, Skorupa K. Internal standards for quantitative RT-PCR studies of gene expression under drought treatment in barley (Hordeum vulgare L.): the effects of developmental stage and leaf age[J]. Acta physiologiae plantarum, 2012, 34(5): 1723-1733.