Difference between revisions of "Hordeum vulgare"

From ICG
Jump to navigation Jump to search
 
(16 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015021-1.jpg|right|272px|]]
+
[[File:Hordeum vulgare.png|right|200px|link=Hordeum vulgare]]
*'''''Hordeum vulgare''''' is one of the most important cereal crops cultivated in the world. Its production in southern Australia is particularly constrained by cyclic and plant terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses. As a model plant with a large amount of genetic and genomic data available, it is still challenging to develop varieties with improved and stable yield in strssed environments with ongoing climate change. Substantial changes in agronomic practices and crop improvement approaches are needed<ref name="ref1"/> <ref name="ref2"/>.
+
*'''''Hordeum vulgare''''' is one of the most important cereal crops cultivated in the world. Its production in southern Australia is particularly constrained by cyclic and plant terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses. As a model plant with a large amount of genetic and genomic data available, it is still challenging to develop varieties with improved and stable yield in strssed environments with ongoing climate change. Substantial changes are needed for crop improvement approaches<ref name="ref1"/> <ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Barley'''
 
* <font color=blue>'''Common Name:'''</font> '''Barley'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4513 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4513 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic & Biotic Stress'''''==
 
=='''''Abiotic & Biotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 22: Line 22:
 
|
 
|
 
* Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
 
* Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
|align="center"| NA
+
|align="center"| [http://www.ncbi.nlm.nih.gov/nuccore/AJ508228.2 '''AJ508228.2''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCTCTCCAACAACATTGCCAAC
 
* F:GCTCTCCAACAACATTGCCAAC
Line 70: Line 70:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''16''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16867362328814749337&as_sdt=2005&sciodt=0,5&hl=en'''16'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Different Developmental stages'''''==
 
=='''''Different Developmental stages'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 90: Line 90:
 
* Drought-induced changes at the seedling stage
 
* Drought-induced changes at the seedling stage
 
* Comparison between seedling and heading stage
 
* Comparison between seedling and heading stage
|align="center"| NA
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ508228.2 '''AJ508228.2''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CGTGACGCTGTGTTGCTTGT
 
* F:CGTGACGCTGTGTTGCTTGT
Line 99: Line 99:
 
|-
 
|-
 
|align="center"| UBI<ref name="ref2"/>
 
|align="center"| UBI<ref name="ref2"/>
|align="center"| ubiquitin
+
|align="center"| Ubiquitin
 
|
 
|
 
* Drought-induced changes at the seedling stage
 
* Drought-induced changes at the seedling stage
|align="center"| NA
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/M60175.1 '''M60175.1''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCGCCGTCCTCCAGTTCTAC
 
* F:TCGCCGTCCTCCAGTTCTAC
Line 114: Line 114:
 
|
 
|
 
* During heading
 
* During heading
|align="center"| NA
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY145451 '''AY145451''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CGACAATGGAACCGGAATG
 
* F:CGACAATGGAACCGGAATG
Line 122: Line 122:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
|align="center"| GAPDH<ref name="ref2"/>
+
|align="center"| GADPH<ref name="ref2"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
 
* During heading
 
* During heading
|align="center"| NA
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/X60343.1 '''X60343.1''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TTCGGCGAGAAGCCAGTTA
 
* F:TTCGGCGAGAAGCCAGTTA
Line 138: Line 138:
 
|
 
|
 
* Comparison between seedling and heading stage
 
* Comparison between seedling and heading stage
|align="center"| NA
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY325266.1 '''AY325266.1''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F: AAGATGGAGGAGGTCGACTAAGC
 
* F: AAGATGGAGGAGGTCGACTAAGC
Line 147: Line 147:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular Types===
* mRNA
+
*mRNA
 +
 
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 158: Line 159:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''23''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=17492077440170478518&as_sdt=2005&sciodt=0,5&hl=en'''23'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 169: Line 170:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]] [[Category:miRNA]] [[Category:mRNA]] [[Category:SYBR]] 
+
=='''Categories'''==
[[Category:ACT]] [[Category:ADP]] [[Category:ADP]] [[Category:GAPDH]] [[Category:HSP90]] [[Category:snoR14]] [[Category:snoR23]] [[Category:Ubiquitin]]
+
[[Category:Plants]][[Category:non-coding RNA]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]] [[Category:ADP]] [[Category:ARF]] [[Category:GAPDH]] [[Category:HSP90]][[Category:Small RNAs]][[Category:Ubiquitin]][[Category:Salinity Treatment]][[Category:Abiotic Stress]] [[Category:Different Developmental Stages]]  [[Category:Fungal infection]][[Category:Biotic Stress]][[Category:Drought Treatment]][[Category:geNorm]] [[Category:NormFinder]] [[Category:BestKeeper]] [[Category:Delta Ct]] [[Category:RefFinder]]
[[Category:Salinity Treatment]] [[Category:Abiotic Stress]] [[Category:Different Developmental Stages]]  [[Category:Fungal infection]] [[Category:Biotic Stress]] [[Category:Drought Treatment]]
 

Latest revision as of 06:52, 1 September 2017

Description

Hordeum vulgare.png
  • Hordeum vulgare is one of the most important cereal crops cultivated in the world. Its production in southern Australia is particularly constrained by cyclic and plant terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses. As a model plant with a large amount of genetic and genomic data available, it is still challenging to develop varieties with improved and stable yield in strssed environments with ongoing climate change. Substantial changes are needed for crop improvement approaches[1] [2].
  • Common Name: Barley
  • NCBI Taxonomy

Abiotic & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Hvu-ADP[1] ADP-ribosylation factor 1-like protein
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
AJ508228.2
  • F:GCTCTCCAACAACATTGCCAAC
  • R:GAGACATCCAGCATCATTCATTCC
77 60 SYBR
Hvu-snoR14[1] Hvu-snoR14
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:GATGTTTATGTATGATAGTCTGTC
  • R:GTCGGGATGTATGCGTGTC
67 60 SYBR
Hvu-snoR23[1] Hvu-snoR23
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:TCGGCAGTGGTGTCATC
  • R:CTCAGTGGAAAGAGAAGTCG
64 60 SYBR

Molecular Types

  • mRNA & miRNA

Evaluation Methods

Contact

  • Name: S.K. Bhure
  • Email: sdbhure@rediffmail.com
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-09-01])

Different Developmental stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ADP[2] ADP-ribozylation factor 1
  • Drought-induced changes at the seedling stage
  • Comparison between seedling and heading stage
AJ508228.2
  • F:CGTGACGCTGTGTTGCTTGT
  • R: CCGCATTCATCGCATTAGG
61 60 SYBR
UBI[2] Ubiquitin
  • Drought-induced changes at the seedling stage
M60175.1
  • F:TCGCCGTCCTCCAGTTCTAC
  • R:CCTTCCTGAGCCTGGTTACCT
63 59 SYBR
ACT[2] Actin
  • During heading
AY145451
  • F:CGACAATGGAACCGGAATG
  • R: CCCTTGGCGCATCATCTC
56 58 SYBR
GADPH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • During heading
X60343.1
  • F:TTCGGCGAGAAGCCAGTTA
  • R:CCTCACCCCACGGGATCT
64 58 SYBR
HSP90[2] Heat shock protein 90
  • Comparison between seedling and heading stage
AY325266.1
  • F: AAGATGGAGGAGGTCGACTAAGC
  • R:GCAGGGCATGGACATACGA
59 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Marcin Rapacz
  • Email: rrrapacz@cyf-kr.edu.pl
  • Institution: Department of Plant Physiology, University of Agriculture in Krakow, Podłu_ zna 3, 30-239 Krako´w, Poland

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Ferdous J, Li Y, Reid N, et al. (2015) Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions. PLoS One 10, e0118503
  2. 2.0 2.1 2.2 2.3 2.4 2.5 Rapacz M, Stępień A, Skorupa K. Internal standards for quantitative RT-PCR studies of gene expression under drought treatment in barley (Hordeum vulgare L.): the effects of developmental stage and leaf age[J]. Acta physiologiae plantarum, 2012, 34(5): 1723-1733.

Categories