Difference between revisions of "Hordeum vulgare"
Jump to navigation
Jump to search
Line 90: | Line 90: | ||
* Drought-induced changes at the seedling stage | * Drought-induced changes at the seedling stage | ||
* Comparison between seedling and heading stage | * Comparison between seedling and heading stage | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ508228.2 '''AJ508228.2'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CGTGACGCTGTGTTGCTTGT | * F:CGTGACGCTGTGTTGCTTGT | ||
Line 102: | Line 102: | ||
| | | | ||
* Drought-induced changes at the seedling stage | * Drought-induced changes at the seedling stage | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/M60175.1 '''M60175.1'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TCGCCGTCCTCCAGTTCTAC | * F:TCGCCGTCCTCCAGTTCTAC | ||
Line 114: | Line 114: | ||
| | | | ||
* During heading | * During heading | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY145451 '''AY145451'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CGACAATGGAACCGGAATG | * F:CGACAATGGAACCGGAATG | ||
Line 126: | Line 126: | ||
| | | | ||
* During heading | * During heading | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/X60343.1 '''X60343.1'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TTCGGCGAGAAGCCAGTTA | * F:TTCGGCGAGAAGCCAGTTA | ||
Line 138: | Line 138: | ||
| | | | ||
* Comparison between seedling and heading stage | * Comparison between seedling and heading stage | ||
− | |align="center"| | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY325266.1 '''AY325266.1'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F: AAGATGGAGGAGGTCGACTAAGC | * F: AAGATGGAGGAGGTCGACTAAGC |
Revision as of 13:34, 29 June 2017
Contents
Description
- Hordeum vulgare is one of the most important cereal crops cultivated in the world. Its production in southern Australia is particularly constrained by cyclic and plant terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses. As a model plant with a large amount of genetic and genomic data available, it is still challenging to develop varieties with improved and stable yield in strssed environments with ongoing climate change. Substantial changes are needed for crop improvement approaches[1] [2].
- Common Name: Barley
- NCBI Taxonomy
Abiotic & Biotic Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Hvu-ADP[1] | ADP-ribosylation factor 1-like protein |
|
AJ508228.2 |
|
77 | 60 | SYBR |
Hvu-snoR14[1] | Hvu-snoR14 |
|
NA |
|
67 | 60 | SYBR |
Hvu-snoR23[1] | Hvu-snoR23 |
|
NA |
|
64 | 60 | SYBR |
Molecular Types
- mRNA & miRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: S.K. Bhure
- Email: sdbhure@rediffmail.com
- Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India
Citation Statistics
Cited by 16 (Based on Google Scholar [2017-06-16])
Different Developmental stages
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ADP[2] | ADP-ribozylation factor 1 |
|
AJ508228.2 |
|
61 | 60 | SYBR |
UBI[2] | Ubiquitin |
|
M60175.1 |
|
63 | 59 | SYBR |
ACT[2] | Actin |
|
AY145451 |
|
56 | 58 | SYBR |
GAPDH[2] | Glyceraldehyde-3-phosphate dehydrogenase |
|
X60343.1 |
|
64 | 58 | SYBR |
HSP90[2] | Heat shock protein 90 |
|
AY325266.1 |
|
59 | 59 | SYBR |
Moleculer types
- mRNA
Evaluation Methods
Contact
- Name: Marcin Rapacz
- Email: rrrapacz@cyf-kr.edu.pl
- Institution: Department of Plant Physiology, University of Agriculture in Krakow, Podłu_ zna 3, 30-239 Krako´w, Poland
Citation Statistics
Cited by 23 (Based on Google Scholar [2017-06-16])
References
- ↑ 1.0 1.1 1.2 1.3 Ferdous J, Li Y, Reid N, et al. (2015) Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions. PLoS One 10, e0118503
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 Rapacz M, Stępień A, Skorupa K. Internal standards for quantitative RT-PCR studies of gene expression under drought treatment in barley (Hordeum vulgare L.): the effects of developmental stage and leaf age[J]. Acta physiologiae plantarum, 2012, 34(5): 1723-1733.