Hordeum vulgare

From ICG
Revision as of 14:10, 15 June 2017 by ICG Expert1 (talk | contribs) (Created page with "==Description== right|272px| * Barley (Hordeum vulgare) is one of the most important cereal crops cultivated in the world and, with a large amoun...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

REFqPCR2015021-1.jpg
  • Barley (Hordeum vulgare) is one of the most important cereal crops cultivated in the world and, with a large amount of genetic and genomic data available, including its full genome sequence, is a model for cereal genomics studies.
  • The average yield of Australian barley is 2 t/ha [1], which is below the world average of 3 t/ha. Barley production in southern Australia is particularly constrained by cyclic and terminal drought in addition to a number of biotic, abiotic and physiochemical subsoil stresses.
  • Yield is a complex quantitative trait whose expression is highly influenced by the environment and agronomic management. This makes phenotype-based selection slow and unreliable, especially under environments where multiple abiotic stresses prevail. Developing barley varieties with improved and stable yield in such environments is expected to be more challenging with ongoing climate change, thus requiring substantial changes in agronomic practices and crop improvement approaches. [1] [2].

Various Stress Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Hvu-ADP[1] ADP-ribosylation factor 1-like protein
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:GCTCTCCAACAACATTGCCAAC
  • R:GCTCTCCAACAACATTGCCAAC
77 60 SYBR
Hvu-snoR14[1] Hvu-snoR14
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:GATGTTTATGTATGATAGTCTGTC
  • R:GATGTTTATGTATGATAGTCTGTC
67 60 SYBR
Hvu-snoR23[1] Hvu-snoR23
  • Drought, fungal infection, boron toxicity, nutrient deficiency and salinity
NA
  • F:TCGGCAGTGGTGTCATC
  • R:TCGGCAGTGGTGTCATC
64 60 SYBR

Moleculer Types

  • mRNA & miRNA

Evaluation Methods

Contact

  • Name: S.K. Bhure
  • Email: sdbhure@rediffmail.com
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

References

  1. 1.0 1.1 1.2 1.3 Ferdous J, Li Y, Reid N, et al. (2015) Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions. PLoS One 10, e0118503
  2. namObsa BT, Eglinton J, Coventry S, et al. (2017) Quantitative trait loci for yield and grain plumpness relative to maturity in three populations of barley (Hordeum vulgare L.) grown in a low rain-fall environment. PLoS One 12, e01781