Difference between revisions of "Humulus lupulus"

From ICG
Jump to navigation Jump to search
Line 13: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 21: Line 21:
 
|align="center"| Yellow leaf specific protein 8  
 
|align="center"| Yellow leaf specific protein 8  
 
|
 
|
* Infection with Vascular Pathogen Verticillium albo-atrum
+
* Infection with vascular pathogen verticillium albo-atrum
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_120912 '''NM_120912''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_120912 '''NM_120912''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 33:
 
|align="center"| DEAD box RNA helicase  
 
|align="center"| DEAD box RNA helicase  
 
|
 
|
* Infection with Vascular Pathogen Verticillium albo-atrum
+
* Infection with vascular pathogen verticillium albo-atrum
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|

Revision as of 11:45, 20 June 2017

Description

Humulus lupulus.jpg
  • Humulus lupulus (common hop or hop) is a species of flowering plant in the Cannabaceae family, native to Europe, western Asia and North America. It is a dioecious, perennial, herbaceous climbing plant which sends up new shoots in early spring and dies back to a cold-hardy rhizome in autumn.
  • Hops are described as bine plants rather than vine because, unlike vines, they have stiff downward facing hairs that provide stability and allow them to climb. These shoots allow H. lupulus to grow anywhere from 15–20 ft. Hops have fragrant wind pollinated flowersthat attract butterflies.
  • The female flowers of the hop plant are used as a preservative and as a flavoring agent in beer[1][2].

Bacteria Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
YLS8[1] Yellow leaf specific protein 8
  • Infection with vascular pathogen verticillium albo-atrum
NM_120912
  • F:CGTACCTGCTTCCACATTTGC
  • R:TCCCAGTCGTGGCCAAAA
NA 60 SYBR
DRH1[1] DEAD box RNA helicase
  • Infection with vascular pathogen verticillium albo-atrum
NA
  • F:CCAACCTACTGGGCTTCGAC
  • R:CAGAATGGGTATGATCGGGC
NA 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Branka Javornik
  • Email: branka.javornik@bf.uni-lj.si
  • Institution: Biotechnical Faculty, Agronomy Department, University of Ljubljana, Ljubljana, Slovenia

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Štajner N, Cregeen S, Javornik B. Evaluation of reference genes for RT-qPCR expression studies in hop (Humulus lupulus L.) during infection with vascular pathogen Verticillium albo-atrum[J]. Plos One, 2013, 8(7): e68228.
  2. S. R. Milligan, J. C. Kalita, A. Heyerick, H. Rong, L. De Cooman, D. De Keukeleire; Identification of a Potent Phytoestrogen in Hops (Humulus lupulus L.) and Beer. J Clin Endocrinol Metab 1999; 84 (6): 2249. doi: 10.1210/jcem.84.6.5887