Humulus lupulus

From ICG
Revision as of 11:01, 16 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== =='''''Infection with Vascular Pathogen Verticillium albo-atrum'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:1...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Infection with Vascular Pathogen Verticillium albo-atrum

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
YLS8[1] Yellow leaf specific protein 8
  • Infection with Vascular Pathogen Verticillium albo-atrum
NM_120912
  • F:CGTACCTGCTTCCACATTTGC
  • R:TCCCAGTCGTGGCCAAAA
NA 60 SYBR
DRH1[1] DEAD box RNA helicase
  • Infection with Vascular Pathogen Verticillium albo-atrum
NA
  • F:CCAACCTACTGGGCTTCGAC
  • R:CAGAATGGGTATGATCGGGC
NA 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Branka Javornik
  • Email: branka.javornik@bf.uni-lj.si
  • Institution: Biotechnical Faculty, Agronomy Department, University of Ljubljana, Ljubljana, Slovenia

References

  1. 1.0 1.1 Štajner N, Cregeen S, Javornik B. Evaluation of reference genes for RT-qPCR expression studies in hop (Humulus lupulus L.) during infection with vascular pathogen Verticillium albo-atrum[J]. Plos One, 2013, 8(7): e68228.