ICG:Genes

From ICG
Revision as of 14:26, 24 June 2017 by Xysj2012 (talk | contribs) (Created page with "{|class="wikitable sortable" style="font-size:10pt" |- ! Gene Symbol ! Gene Name !style="width=25% font-size:9pt "| Application Scope ! Accession Number ! Primers (5...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search
Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HMBS[1] Hydroxymethylbilane synthase
  • Universial reference gene for gene expression studies in HCC
NM_000190.3
  • F: TGCAACGGCGGAAGAAAA
  • R: ACGAGGCTTTCAATGTTGCC
113 56.4 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Tumoral and adjacent non-tumoral tissues derived from patients with HCC
  • Liver cancer cell lines: Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
NM_012423
  • F: TGCACCACCAACTGCTTAGC
  • R: GGCATGGACTGTGGTCATGAG
87 56.4 SYBR
UBC[1] Ubiquitin C
  • Tumor tissues
NM_021009.3
  • F: CGGTGAACGCCGATGATTAT
  • R: ATCTGCATTGTCAAGTGACGA
124 56.4 SYBR
SDHA[1] Succinate dehydrogenase complex, subunit A
  • Liver cancer cell lines: Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182
NM_004168.2
  • F: TGGGAACAAGAGGGC ATCTG
  • R: CCACCACTGCATCAAATTCATG
86 56.4 SYBR
  1. 1.0 1.1 1.2 1.3 Cite error: Invalid <ref> tag; no text was provided for refs named ref23